Que circula MicroARN Cuantificación Usando ADN vinculante tinte Química y gotita de PCR digital
Summary
A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.
Abstract
Circulación (de libres de células) microRNAs (miRNAs) son liberados de las células en el torrente sanguíneo. La cantidad de microRNAs específicos en la circulación se ha relacionado con un estado de enfermedad y tiene el potencial para ser utilizado como biomarcador de la enfermedad. Un método sensible y exacto para la circulación de la cuantificación de microARN usando una química a base de colorante y tecnología de gotas de PCR digital ha sido desarrollado recientemente. Específicamente, utilizando ácido nucleico cerrado (LNA) a base de cebadores-miARN específico con un colorante de unión a ADN fluorescente verde en un sistema digital de PCR gotita compatible es posible obtener la cuantificación absoluta de miRNAs específicos. A continuación, se describe la forma de realizar esta técnica para evaluar la cantidad de miRNA en fluidos biológicos, tales como plasma y suero, es factible y eficaz.
Introduction
MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14.
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.
Protocol
Representative Results
Discussion
miRNAs circulantes están presentes en la sangre en concentraciones extremadamente bajas y la cantidad de ARN que se puede extraer a partir de muestras de plasma y suero es baja. Por esta razón, son difíciles de cuantificar con otras técnicas tales como microarrays y secuenciación de ARN. Por otra parte, hay una falta generalizada de acuerdo sobre la normalización de datos y la presencia de miRNAs endógenos "de referencia" en la sangre. En este contexto, una tecnología sensible como gotita PCR digital, …
Disclosures
The authors have nothing to disclose.
Acknowledgements
Con el apoyo de fondos de la Asociación Italiana para la Investigación del Cáncer (AIRC) en MF (GPA 11676) y MN (Oncología Clínica Molecular Programa Especial -. 5 por mil n 9980, 2010/15) y del Ministerio Italiano de Instrucción, Universidad y Investigación FIRB 2011 al MN (Proyecto RBAPIIBYNP).
Materials
| miRNeasy Mini Kit | Qiagen | 217004 | Columns for total RNA, including miRNA, extraction from serum/plasma |
| 100 nmole RNA oligo Cel-miR-39-3p | Integrated DNA Technologies | Custom | Sequence: UCACCGGGUGUAAAUCAGCUUG |
| Universal cDNA synthesis kit II, 8-64 rxns | Exiqon | 203301 | Kit for microRNA reverse transcription |
| MicroRNA LNA PCR primer set | Exiqon | 204000-206xxx and 2100000-21xxxxx | Primers for miRNA amplification inside droplets |
| QX200 droplet generator | BioRad | 186-4002 | Instrument used for droplet reading |
| QX200 droplet reader | BioRad | 186-4003 | Instrument used for droplet generation |
| QuantaSoft software | BioRad | 186-3007 | Software for data collection and analysis |
| PX1 PCR plate sealer | BioRad | 181-4000 | Plate sealer |
| DG8 droplet generator cartridges and gaskets | BioRad | 186-4008 | Cartridges used to mix sample and oil to generate droplets |
| QX200 ddPCR EvaGreen supermix | BioRad | 186-4033/36 | PCR supermix |
| QX200 droplet generator oil for EvaGreen dye | BioRad | 186-4005 | Oil for droplet generation |
References
- Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
- Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
- Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
- Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
- Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
- Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
- Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
- Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
- Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
- Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
- Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
- Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
- Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. , (2015).
- Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. , (2015).
- Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
- Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).
