-Microscopie gebaseerde testen voor high-throughput screening van Host factoren die betrokken zijn in<em> Brucella</em> Infectie van Hela cellen
Summary
Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.
Abstract
Brucella soorten zijn facultatief intracellulaire pathogenen dat dieren besmetten als hun natuurlijke gastheren. Overdracht op de mens wordt meestal veroorzaakt door direct contact met besmette dieren of door inname van besmet voedsel en kan leiden tot ernstige chronische infecties.
Brucella kunnen binnenvallen professionele en niet-professionele fagocytische cellen en repliceert binnen endoplasmatisch reticulum (ER) afgeleide vacuolen. De gastheer factoren die nodig zijn voor Brucella binnenkomst in gastheercellen, het vermijden van lysosomale degradatie en replicatie in de ER-achtige compartiment blijven grotendeels onbekend. Hier beschrijven we twee assays gastheerfactoren betrokken bij Brucella binnenkomst en replicatie in HeLa cellen te identificeren. De protocollen beschrijven het gebruik van RNA interferentie, terwijl alternatieve screeningmethoden worden toegepast. De assays zijn gebaseerd op de detectie van fluorescent gelabelde bacteriën fluorescent gelabelde gastheercellen middels geautomatiseerdewide-microscopie. De fluorescerende beelden worden geanalyseerd met behulp van een gestandaardiseerde beeldanalyse pijpleiding CellProfiler die eencellige gebaseerde infectie scoring mogelijk maakt.
In het eindpunt assay wordt intracellulaire replicatie gemeten twee dagen na infectie. Dit maakt het mogelijk bacteriën om verkeer naar hun replicatieve niche waar de proliferatie wordt geïnitieerd ongeveer 12 uur na bacteriële binnenkomst. Brucella die met succes hebben gevestigd een intracellulaire niche zal dus sterk hebben zich verspreid in gastheercellen. Sinds intracellulaire bacteriën sterk individuele extracellulaire of intracellulaire niet-replicatieve bacteriën overtreffen, kan een stam die constitutief GFP worden gebruikt. De sterke GFP signaal wordt vervolgens gebruikt om geïnfecteerde cellen te identificeren.
In tegenstelling, voor de toevoeging test is het belangrijk om onderscheid te maken tussen de intracellulaire en extracellulaire bacteriën. Hier wordt een stam codeert voor een tetracycline-induceerbare GFP gebruikt. Inductievan GFP met gelijktijdige inactivering van extracellulaire bacteriën door gentamicine maakt het onderscheid tussen intracellulaire en extracellulaire bacteriën op basis van het GFP-signaal, slechts intracellulaire bacteriën te kunnen GFP expressie. Hierdoor kan de robuuste detectie van enkele intracellulaire bacteriën voor intracellulaire proliferatie wordt geïnitieerd.
Introduction
Brucella species zijn gram-negatieve, facultatief intracellulaire pathogenen die behoren tot de klasse van α-Proteobacteria. Ze veroorzaken abortussen en onvruchtbaarheid in hun natuurlijke gastheren zoals koeien, geiten of schapen wat resulteert in ernstige economische verliezen in endemische gebieden. Brucellose is een van de belangrijkste zoönosen wereldwijd waardoor meer dan een half miljoen nieuwe infecties bij mensen per jaar 1. Toezending aan de mens wordt meestal veroorzaakt door direct contact met besmette dieren of door inname van besmet voedsel, zoals ongepasteuriseerde melk. Symptomen van febriele ziekte aspecifieke, die problemen veroorzaakt bij de diagnose van brucellose. Indien onbehandeld, kunnen de patiënten een chronische infectie te ontwikkelen met meer ernstige symptomen zoals artritis, endocarditis en neuropathie 2.
Op cellulair niveau Brucella kan fagocytische en niet-fagocytische cellen binnendringen en repliceert in een intracellulairecompartiment bekend als de Brucella-bevattende vacuole (BCV). Internalisering van bacteriën vereist actine cytoskelet herschikkingen door Rac, Rho, en directe activatie van Cdc42 3. Binnen de eukaryotische gastheercel, de BCV trafieken langs de endocytische route en ondanks de interactie met lysosomen, bacteriën erin slagen om degradatie te vermijden 4. Aanzuring van de BCV de vesiculaire ATPase moet de expressie van het bacteriële type IV secretie systeem (T4SS) 5 induceren. Men gelooft dat bacteriële effectoren afgescheiden door de T4SS essentieel zijn voor Brucella zijn replicatieve niche tonen, aangezien deletie van de T4SS 6 of remming van de vesiculaire ATPase leiden tot defecten in de inrichting van de intracellulaire niche 7. Bacteriën niet herhalen tijdens de fase van de handel tot ze bereiken een-ER afgeleid vacuolaire compartiment 8. Zodra intracellulaire proliferatie optreedt, wordt de BCV in close associatie met ER merkers zoals calnexin en glucose-6-fosfatase 6.
De moleculaire mechanismen die Brucella binnenkomt cellen, vermijdt lysosomale degradatie en tenslotte repliceert in een ER-achtige compartiment blijven grotendeels onbekend. Host factoren die betrokken zijn in verschillende stappen van de infectie zijn voornamelijk geïdentificeerd door een gerichte aanpak of een kleine schaal kleine interfererende RNA-scherm (siRNA) uitgevoerd in Drosophila cellen 9. Deze zijn licht werpen op de bijdrage van individuele gastheer factoren tijdens Brucella infectie, maar we zijn nog ver verwijderd van een beter begrip van het gehele proces.
Hier, protocollen die de identificatie van menselijke gastheer factoren met behulp van grootschalige RNA interferentie (RNAi) screening in combinatie met geautomatiseerde wide-field fluorescentie microscopie en geautomatiseerde beeldanalyse mogelijk worden gepresenteerd. Reverse siRNA transfectie van HeLa-cellen wordt uitgevoerd zoals described eerder 10,11 met kleine aanpassingen. Het eindpunt assay beslaat een groot deel van de levenscyclus Brucella intracellulaire behalve de uitgang en de infectie van naburige cellen. De treffers die in het eindpunt assay verder te karakteriseren, wordt een gemodificeerd protocol factoren betrokken bij vroege stappen van de infectie te identificeren gebruikt.
Een Brucella abortus stam die constitutief tot expressie GFP wordt gebruikt voor het eindpunt assay waarin bacteriën mogen cellen te infecteren gedurende twee dagen. Gedurende deze tijd, bacteriën in cellen, verkeer naar de ER-afgeleide replicatieve niche en repliceren in de peri-nucleaire space. De hoge niveaus van GFP-signaal kan dan worden gebruikt op betrouwbare wijze vast afzonderlijke replicerende cellen die bacteriën bevatten.
Om Brucella invoer in een high-throughput assay bestuderen, is het belangrijk om onderscheid te kunnen maken tussen de intracellulaire en extracellulaire bacteriën. De methode die hier circumv gepresenteerdeents differentiële antilichaam kleuring van intracellulaire en extracellulaire bacteriën. Het is gebaseerd op een Brucella stam die een tetracycline-induceerbare GFP in combinatie met constitutieve expressie van DsRed. De aanwezigheid van een constitutieve DsRed merker maakt de identificatie van bacteriën die in het monster aanwezig zijn. GFP expressie wordt geïnduceerd door toevoeging van de niet-toxische tetracycline analoog anhydrotetracycline (ATC) gelijktijdig met inactivering van extracellulaire bacteriën door gentamicine (Gm). Terwijl de cel-ondoordringbare antibioticum Gm doodt extracellulaire bacteriën, kunnen ATC de gastheercel in te voeren en te induceren GFP expressie selectief in intracellulaire bacteriën. Deze dubbele verslaggever maakt de robuuste scheiding van enkele intracellulaire bacteriën (GFP en DsRed signaal) van de extracellulaire bacteriën (alleen DsRed signaal) met behulp van wide-field microscopie. Om detecteerbare GFP expressie bereikt door intracellulaire Brucella gebleken dat 4 uur van inductie door atc resulteert in een betrouw-staat signaal. Vertaald inductie schema selectief GFP expressie in intracellulaire bacteriën is eerder gebruikt om intracellulaire Shigella 12 bestuderen.
Protocol
Representative Results
Discussion
Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellul…
Disclosures
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program “Fellowships for Excellence” of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.
Materials
| Tryptic Soy Agar (TSA) | BD | 236950 | |
| Tryptic Soy Broth (TSB) | Fluka | 22092 | |
| Kanamycin sulfate | Sigma-Aldrich | 60615 | |
| Skim milk | |||
| 250 ml screw cap bottle | Corning | 8396 | |
| DMEM | Sigma-Aldrich | D5796 | |
| Fetal Calf Serum (FCS) | Gibco | 10270 | Heat-inactivated |
| Trypsin-EDTA (0.5%) | Gibco | 15400-054 | 10x stock solution, dilute 1:10 in PBS |
| Scepte 2.0 Cell Counter | Merck Milipore | PHCC20060 | Alternative cell counting devices can be used. |
| Greiner CELLSTAR 384-well plate | Sigma-Aldrich | M2062 | |
| Peelable aluminum foil | Costar | 6570 | |
| Reagent dispenser: "Multidrop 384 Reagent Dispenser" | Thermo Scientific | 5840150 | Alternative reagent dispenser can be used. |
| Transfection reagent: "Lipofectamine RNAiMAX | Invitrogen | 13778-150 | |
| Automated plate washer: "Plate washer ELx50-16" | BioTek | ELX5016 | This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used. |
| Gentamicin | Sigma-Aldrich | G1397 | |
| Anhydrotetracycline hydrochloride | Sigma-Aldrich | 37919 | 100 ug/ml solution in 100% ethanol is kept at -20°C protected from light in aluminum-foil |
| PBS | Gibco | 20012 | |
| Paraformaldehyde | Sigma-Aldrich | P6148 | Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20°C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed. |
| HEPES | Sigma-Aldrich | H3375 | |
| Triton X-100 | Sigma-Aldrich | T9284 | |
| DAPI | Roche | 10236276001 | |
| Scrambled siRNA | Dharmacon | D-001810-10 | |
| Kif11 siRNA | Dharmacon | L-003317-00 | |
| ARPC3 siRNA | Dharmacon | L-005284-00 | |
| Brucella abortus 2308 | |||
| pJC43 (apHT::GFP) | Celli et al.12 | ||
| pAC042.08 (apht::dsRed, tetO::tetR-GFP) | Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector. | ||
| Primer prAC090 | Sigma-Aldrich | TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC | |
| Primer prAC092 | Sigma-Aldrich | TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC | |
| HeLa CCL-2 | ATCC | CCL-2 | |
| ImageXpress Micro | Molecular Devices | IXM IMAGING MSCOPE | Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed. |
| High-Speed Laser Auto-Focus | Molecular Devices | 1-2300-1037 | |
| CFI Super Fluor 10x objective | Nikon | MRF00100 | N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded |
| Photometrics CoolSNAP HQ Monochrome CCD Camera | Molecular Devices | 1-2300-1060 | 1392 x 1040 imaging pixels, 6.45 x 6.45-µm pixels, 12 bits digitization |
| MetaXpress software | Molecular Devices | 9500-0100 | |
| LUI-Spectra-X-7 | Lumencor | SPECTRA X V-XXX-YZ | Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP) |
| Single Band Exciter for DAPI | Semrock | FF01-377/50-25 | |
| Single Band Emitter for DAPI | Semrock | FF02-447/60-25 | |
| Single Band Dichroic for DAPI | Semrock | FF409-Di03-25×36 | |
| Single Band Exciter for GFP | Semrock | FF02-472/30-25 | |
| Single Band Emitter for GFP | Semrock | FF01-520/35-25 | |
| Single Band Dichroic for GFP | Semrock | FF495-Di03-25×36 | |
| Single Band Exciter for RFP | Semrock | FF01-562/40-25 | |
| Single Band Emitter for RFP | Semrock | FF01-624/40-25 | |
| Single Band Dichroic for RFP | Semrock | FF593-Di03-25×36 |
References
- Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. The new global map of human brucellosis. Lancet Infect Dis. 6, 91-99 (2006).
- Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. Interactions of the human pathogenic Brucella species with their hosts. Annu Rev Microbiol. 65, 523-541 (2011).
- Guzman-Verri, C., et al. GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42. J Biol Chem. 276, 44435-44443 (2001).
- Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment. Traffic. 9, 678-694 (2008).
- Boschiroli, M. L., et al. The Brucella suis virB operon is induced intracellularly in macrophages. Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).
- Celli, J., et al. Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum. J Exp Med. 198, 545-556 (2003).
- Porte, F., Liautard, J. P., Kohler, S. Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages. Infect Immun. 67, 4041-4047 (1999).
- Anderson, T. D., Cheville, N. F. Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum. Am J Pathol. 124, 226-237 (1986).
- Qin, Q. M., et al. RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication. PLoS Pathog. 4, e1000110 (2008).
- Ramo, P., et al. Simultaneous analysis of large-scale RNAi screens for pathogen entry. BMC genomics. 15, 1162 (2014).
- Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes. J Vis Exp. , e51043 (2013).
- Kentner, D., et al. Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth. Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).
- Celli, J., Salcedo, S. P., Gorvel, J. P. Brucella coopts the small GTPase Sar1 for intracellular replication. Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).
- von Bargen, K., Gorvel, J. P., Salcedo, S. P. Internal affairs: investigating the Brucella intracellular lifestyle. FEMS microbiology reviews. 36, 533-562 (2012).
- Kamentsky, L., et al. Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software. Bioinformatics. 27, 1179-1180 (2011).
