에 참여 호스트 요인의 높은 처리량 검사에 대한 현미경 기반 분석 실험<em> 브루셀라</em> HeLa 세포의 감염
Summary
Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.
Abstract
브루셀라 종은 자연 호스트로 동물을 감염 통성 세포 내 병원균이다. 인간에게 전송은 가장 일반적으로 감염된 동물과 직접 접촉하거나 오염 된 음식의 섭취에 의해 발생되고 심한 만성 감염으로 이어질 수 있습니다.
브루셀라 전문 및 비 전문 식세포의 세포 침입과 소포체 (ER) 유래 액포 내에서 복제 할 수 있습니다. 응급실과 같은 구획 브루셀라 숙주 세포에 진입, 리소좀 분해 회피 및 복제에 필요한 숙주 요인은 거의 알려져 남아있다. 여기에서 우리는 HeLa 세포에서 브루셀라 항목 및 복제에 관련된 호스트 요인을 파악하기 위해이 분석에 대해 설명합니다. 다른 검사 방법을 적용 할 수 있지만 프로토콜은 RNA 간섭의 사용을 설명한다. 분석법은 형광 표지 된 세균의 검출에 사용 자동 형광 표지 된 숙주 세포에 기초와이드 필드 현미경. 형광 이미지는 단일 셀 기반 감염 득점을 허용 CellProfiler에서 표준 이미지 분석 파이프 라인을 이용하여 분석한다.
엔드 분석에서, 세포 내 복제 이틀 감염 후 측정한다. 이 확산 성공적으로 이렇게 강하게 숙주 세포 내에서 증식 할 것이다 세포 내 틈새를 설립 세균 항목입니다. 브루셀라 후 12 시간의 주위에 시작되는 자신의 복제 성 틈새 트래픽에 박테리아를 할 수 있습니다. 세포 내 박테리아가 크게 개별 세포 또는 세포 비 – 복제 성 박테리아를 능가하기 때문에, 구조적으로 GFP를 발현하는 균주를 사용할 수있다. 강한 GFP 신호는 감염된 세포를 식별하기 위해 사용된다.
대조적으로, 엔트리 분석을 위해 세포 내 및 세포 외 박테리아를 구별하는 것이 필수적이다. 여기에서, 테트라 사이클린 – 유도 GFP에 대한 변형 부호화가 사용된다. 유도겐타 마이신에 의한 세포 외 박테리아의 불 활성화와 동시에 GFP의 세포 내 박테리아 GFP를 발현 할 수있는 함께 세포 및 GFP 신호에 기초하여 박테리아 세포의 분화를 가능하게한다. 세포 내 증식이 시작되기 전에이 단일 세포 내 박테리아의 강력한 탐지 할 수 있습니다.
Introduction
브루셀라 종은 α-프로 테오 박테리아의 클래스에 속하는 그람 음성, 통성 세포 내 병원균이다. 그들은 이러한 풍토 지역에서 심각한 경제적 손실을 초래 소, 염소, 또는 양 등 자연 호스트에서 낙태와 불임의 원인. 브루셀라 병은 전 세계적으로 매년 50 만 새로운 인간 감염 1 위에 일으키는 가장 중요한 인수 공통 질병 중 하나입니다. 인간에 전송 가장 일반적으로 이러한 저온 살균하지 않은 우유로 감염된 동물과 직접 접촉하거나 오염 된 음식의 섭취에 의해 발생합니다. 열성 질환의 증상은 브루셀라 병의 진단에 어려움이 발생하는 불특정입니다. 처리되지 않은 경우, 환자는 관절염, 심내막염, 및 신경 병증이 같은 더 심각한 증상으로 만성 감염을 개발할 수 있습니다.
세포 수준에서 브루셀라 식세포는 비 식세포에 침입 할 수 있으며, 세포 내에서 복제브루셀라 함유 공포 (BCV)라고 함. 박테리아의 내면화는 라 세미,의 Rho와 Cdc42 3의 직접적인 활성화에 의해 액틴 세포 골격의 재 배열이 필요합니다. 진핵 숙주 세포 내부에서 BCV는 세포 내 이입 경로를 따라 트래 피킹과 리소좀과의 상호 작용에도 불구하고, 세균 분해 4 않도록 관리한다. 소낭 ATPase에 의해 BCV의 산성화가 박테리아 타입 IV 분비 시스템 (T4SS) (5)의 발현을 유도 할 필요가있다. 브루셀라는 복제 성 틈새 시장을 확립하기위한 T4SS 분비 세균 이펙터는 세포 내 틈새 시장 (7)의 설립의 결함에 T4SS 6의 삭제 또는 기공을 ATP 아제 리드의 억제 때문에, 필수적인 것으로 생각된다. 박테리아는 그들이 때까지 인신 매매의 단계에서 복제되지 않는다 응급실에서 파생 된 액포 실 (8)에 도달한다. 세포 증식이 발생되면, BCV는 CL에서 발견이러한 calnexin 및 글루코스 -6- 인산 (6)와 같은 ER 마커 OSE 협회.
브루셀라는 ER-같은 구획, 세포를 입력 리소좀 저하를 방지하고, 마지막으로 복제하는 분자 메커니즘은 크게 알려지지 않은 남아있다. 감염의 여러 단계에 관여하는 호스트 요소는 주로 대상으로 접근 또는 초파리 세포 (9)에서 수행되는 작은 규모의 작은 간섭 RNA (siRNA를) 스크린에 의해 확인되었다. 다음은 브루셀라 감염시 개별 호스트 요인의 기여에 광명을 비춰했지만 우리는 전체 과정의 포괄적 인 이해에서 멀리 아직도이다.
여기서, 자동 폭 필드 형광 현미경 및 자동화 된 이미지 분석과 함께 대규모 RNA 간섭 (RNAi의) 검사를 사용하여 인간 숙주 인자의 식별을 허용 프로토콜이 제시된다. HeLa 세포의 뒷면의 siRNA로 형질 describ 수행에드 이전 10, 11 약간의 수정과. 엔드 포인트 분석은 상기 출구와 인접 셀의 감염을 제외한 브루셀라 세포 수명의 많은 부분을 포함한다. 상기 엔드 분석에서 확인 된 히트를 특성화하기 위해, 감염의 초기 단계에 관여하는 인자들을 확인하는 변형 프로토콜이 사용된다.
구조적 GFP를 발현하는 브루셀라 아 보르 투스 균주 박테리아 이틀 동안 세포를 감염시킬 수있는 엔드 포인트 분석에 사용된다. 이 기간 동안, 박테리아는 ER-파생 된 복제 성 틈새 시장 세포, 트래픽을 입력하고 요정 핵 공간에 복제합니다. GFP 신호의 하이 레벨은 안정적으로 복제 박테리아를 포함 개별 셀을 검출 할 수있다.
고 처리량 분석에 브루셀라 항목을 연구하기 위해, 세포 내 및 세포 외 박테리아를 구별 할 수있는 것이 중요하다. 이 방법은 여기 circumv 제시세포 내 및 세포 외 박테리아의 엔트 차 항체 염색. 그것은을 DsRed의 구성 성 발현과 함께 테트라 사이클린 – 유도 GFP를 발현하는 브루셀라 변형에 기초한다. 구성 적을 DsRed 마커의 존재는 샘플에 존재하는 모든 균을 식별 할 수있다. GFP 발현 젠타 의해 동시에 세포 외 박테리아의 불 활성화와 함께 무독성 테트라 사이클린 유사체 anhydrotetracycline (ATC)의 첨가 (GM)에 의해 유도된다. 셀 배리어 성 항생제 GM은 세포 외 박테리아를 죽이고 있지만, ATC는 숙주 세포를 선택하고 박테리아 세포 내에서 선택적으로 GFP 발현을 유도 할 수있다. 이 듀얼 기자는 넓은 필드 현미경을 사용하여 세포 외 박테리아 (만을 DsRed 신호)에서 단일 세포 내 세균 (GFP 및을 DsRed 신호)의 강력한 분리 할 수 있습니다. 세포 브루셀라 의해 검출 GFP 발현에 도달하기 위해 우리는 ATC에 의해 유도 4 시간이 RELI 초래한다는 발견수 신호. 선택적으로 세포 내 세균에 GFP를 표현하는 유사 유도 방식은 세포 내 시겔 (12)을 연구하기 위해 이전에 사용되었습니다.
Protocol
Representative Results
Discussion
Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellul…
Disclosures
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program “Fellowships for Excellence” of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.
Materials
| Tryptic Soy Agar (TSA) | BD | 236950 | |
| Tryptic Soy Broth (TSB) | Fluka | 22092 | |
| Kanamycin sulfate | Sigma-Aldrich | 60615 | |
| Skim milk | |||
| 250 ml screw cap bottle | Corning | 8396 | |
| DMEM | Sigma-Aldrich | D5796 | |
| Fetal Calf Serum (FCS) | Gibco | 10270 | Heat-inactivated |
| Trypsin-EDTA (0.5%) | Gibco | 15400-054 | 10x stock solution, dilute 1:10 in PBS |
| Scepte 2.0 Cell Counter | Merck Milipore | PHCC20060 | Alternative cell counting devices can be used. |
| Greiner CELLSTAR 384-well plate | Sigma-Aldrich | M2062 | |
| Peelable aluminum foil | Costar | 6570 | |
| Reagent dispenser: "Multidrop 384 Reagent Dispenser" | Thermo Scientific | 5840150 | Alternative reagent dispenser can be used. |
| Transfection reagent: "Lipofectamine RNAiMAX | Invitrogen | 13778-150 | |
| Automated plate washer: "Plate washer ELx50-16" | BioTek | ELX5016 | This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used. |
| Gentamicin | Sigma-Aldrich | G1397 | |
| Anhydrotetracycline hydrochloride | Sigma-Aldrich | 37919 | 100 ug/ml solution in 100% ethanol is kept at -20°C protected from light in aluminum-foil |
| PBS | Gibco | 20012 | |
| Paraformaldehyde | Sigma-Aldrich | P6148 | Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20°C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed. |
| HEPES | Sigma-Aldrich | H3375 | |
| Triton X-100 | Sigma-Aldrich | T9284 | |
| DAPI | Roche | 10236276001 | |
| Scrambled siRNA | Dharmacon | D-001810-10 | |
| Kif11 siRNA | Dharmacon | L-003317-00 | |
| ARPC3 siRNA | Dharmacon | L-005284-00 | |
| Brucella abortus 2308 | |||
| pJC43 (apHT::GFP) | Celli et al.12 | ||
| pAC042.08 (apht::dsRed, tetO::tetR-GFP) | Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector. | ||
| Primer prAC090 | Sigma-Aldrich | TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC | |
| Primer prAC092 | Sigma-Aldrich | TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC | |
| HeLa CCL-2 | ATCC | CCL-2 | |
| ImageXpress Micro | Molecular Devices | IXM IMAGING MSCOPE | Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed. |
| High-Speed Laser Auto-Focus | Molecular Devices | 1-2300-1037 | |
| CFI Super Fluor 10x objective | Nikon | MRF00100 | N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded |
| Photometrics CoolSNAP HQ Monochrome CCD Camera | Molecular Devices | 1-2300-1060 | 1392 x 1040 imaging pixels, 6.45 x 6.45-µm pixels, 12 bits digitization |
| MetaXpress software | Molecular Devices | 9500-0100 | |
| LUI-Spectra-X-7 | Lumencor | SPECTRA X V-XXX-YZ | Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP) |
| Single Band Exciter for DAPI | Semrock | FF01-377/50-25 | |
| Single Band Emitter for DAPI | Semrock | FF02-447/60-25 | |
| Single Band Dichroic for DAPI | Semrock | FF409-Di03-25×36 | |
| Single Band Exciter for GFP | Semrock | FF02-472/30-25 | |
| Single Band Emitter for GFP | Semrock | FF01-520/35-25 | |
| Single Band Dichroic for GFP | Semrock | FF495-Di03-25×36 | |
| Single Band Exciter for RFP | Semrock | FF01-562/40-25 | |
| Single Band Emitter for RFP | Semrock | FF01-624/40-25 | |
| Single Band Dichroic for RFP | Semrock | FF593-Di03-25×36 |
References
- Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. The new global map of human brucellosis. Lancet Infect Dis. 6, 91-99 (2006).
- Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. Interactions of the human pathogenic Brucella species with their hosts. Annu Rev Microbiol. 65, 523-541 (2011).
- Guzman-Verri, C., et al. GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42. J Biol Chem. 276, 44435-44443 (2001).
- Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment. Traffic. 9, 678-694 (2008).
- Boschiroli, M. L., et al. The Brucella suis virB operon is induced intracellularly in macrophages. Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).
- Celli, J., et al. Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum. J Exp Med. 198, 545-556 (2003).
- Porte, F., Liautard, J. P., Kohler, S. Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages. Infect Immun. 67, 4041-4047 (1999).
- Anderson, T. D., Cheville, N. F. Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum. Am J Pathol. 124, 226-237 (1986).
- Qin, Q. M., et al. RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication. PLoS Pathog. 4, e1000110 (2008).
- Ramo, P., et al. Simultaneous analysis of large-scale RNAi screens for pathogen entry. BMC genomics. 15, 1162 (2014).
- Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes. J Vis Exp. , e51043 (2013).
- Kentner, D., et al. Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth. Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).
- Celli, J., Salcedo, S. P., Gorvel, J. P. Brucella coopts the small GTPase Sar1 for intracellular replication. Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).
- von Bargen, K., Gorvel, J. P., Salcedo, S. P. Internal affairs: investigating the Brucella intracellular lifestyle. FEMS microbiology reviews. 36, 533-562 (2012).
- Kamentsky, L., et al. Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software. Bioinformatics. 27, 1179-1180 (2011).
