JoVE Journal > Medicine
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
자동 번역
Please note that all translations are automatically generated. Click here for the English version.
의학

준비 및<em> 체외</em> 자화 특성의 내피 세포를 미르 변성

Published: May 02, 2017
doi:
10.3791/55567
, , , , , ,
1Reference and Translation Center for Cardiac Stem Cell Therapy (RTC), Department of Cardiac Surgery,University of Rostock, 2Physikalisch-Technische Bundesanstalt, 3Department of Radiology and Neuroradiology,Ernst-Moritz-Arndt-University Greifswald, 4Electron Microscopy Center,University of Rostock

Summary

이 원고는 PEI / MNP 벡터와 자신의 자화에 의해 내피 세포 수 미르 효율적인 비 바이러스 성 전달을 설명합니다. 따라서, 유전자 변형뿐만 아니라,이 방법은 자기 세포 안내와 MRI의 검출 능력 수 있습니다. 이 기술은 치료 세포 제품의 특성을 개선하는 데 사용할 수 있습니다.

Abstract

현재까지, 심혈관 질환에 사용할 수있는 수술 및 약물 치료 (CVD)는 제한적이며 종종 완화. 동시에, 유전자 및 세포 치료는 CVD 치료에 매우 유망한 대안 적 방법을 제공합니다. 그러나, 유전자 치료의 다양한 임상 적 적용이 매우 적합 유전자 전달 시스템의 부족에 의해 제한된다. 적절한 유전자 전달 벡터의 개발은 세포 치료의 현재 문제점에 대한 해결책을 제공 할 수있다. 등 부상 기관에 제한 효율성과 낮은 세포 유지와 같은 특히, 기존의 단점에서, 적절한 세포 공학에 의해 (즉, 유전) 이전에 이식에 극복 할 수있다. 제시된 프로토콜은 폴리에틸렌 초상 자성 나노 입자 (PEI / MNP) 기반 전달 벡터를 사용하여 내피 세포의 효율적이고 안전한 과도 변형 례를 설명한다. 또한, 알고리즘과 셀 특성화 방법이 정의되어있다. 성공적인 intracellu마이크로 RNA 인간 제대 정맥 내피 세포로 (은 miR) (HUVEC를)의 경 전달 세포 생존, 기능, 또는 간 통신에 영향을주지 않고 달성되었다. 또한,이 방법은 소개 외생은 miR에서 강력한 기능 효과를 일으킬 것으로 입증되었다. 중요한 것은,이 MNP 기반 벡터의인가는 자기 타겟팅 및 비 침습성 MRI 추적 가능성을 수반 셀 자화를 보장한다. 이것은 MRI와 비 침습적 모니터링 할 수있는 자기 유도, 유 전적으로 조작 된 세포 치료제를위한 기초를 제공 할 수있다.

Introduction

유전자 및 세포 치료는 CVD 처리에 현재의 문제를 해결할 가능성이있는 강력한 도구입니다. 이러한 접근 방법 모두 현재 임상 실험에서 테스트되고 있다는 사실에도 불구하고, 그들은 아직 다양한 임상 적 적용 일에 대한 준비가되지 않습니다. 특히, 유전자 및 세포 치료의 과제를 해결하는 일반적인 접근 방식은 임상 적 적용에 적합한 다기능 유전자 전달 벡터를 개발하는 것입니다. 안전하고 효율적인 유전자 전달 시스템의 부족은 유전자 치료의 주요 관심사입니다. 동시에, 세포 제품의 유전 공학 낮은 효율 (예를 들어, 심장 분야에서 기능 개선 만 ~ 5 % 달성 후 줄기 세포 이식 1과 세포 치료의 심각한 도전을 극복 할 수 이식에 앞서 시간 포 분 이내에 10 % -)와 가난한 유지 / 상해의 사이트에 생착이 (즉, 세포의 유지는 아래 5 방울세인트 애플리케이션, 투여 경로에 관계없이 2, 3, 4).

현재까지, 바이러스 벡터가 크게 임상 시험에서의 넓은 응용 가져왔다 효율의 관점에서 비 바이러스 시스템 (~ 67 %)를 초과 5. 그러나 바이러스 차량은 실시 유전 물질 (6)의 크기에 심각한 (심각한 합병증 및 후속 염증 반응) 등의 면역 원성 등의 위험, 관련한 종양 및 제한을 실시한다. 이러한 안전 문제 및 바이러스 벡터 생산의 높은 비용으로 인해, 비 바이러스 시스템의 사용은 어떤 경우 7, 8 바람직하다. 여기에는 (CVD 처리에 대한 예)를 제어 혈관 성장 인자의 발현 유전자로서 과도 보정을 필요 이상, 또는 대인 수수에 특히 적합백신의 스피.

우리 그룹에서, 전달 시스템은 지형 25 kDa의 폴리에틸렌 이민 (PEI)과 비오틴 – 스트렙 트 아비딘 상호 작용 (9)에 의해 함께 결합 초상 자성 산화철 나노 입자 (MNP)를 조합하여 설계되었다. 이 벡터는 이전의 이식에 대한 그들의 동시 자화를 허용 세포의 유전 공학에 대한 잠재적 인 도구입니다. 후자는 고급 자기 타겟팅 기술이 성공적으로 10을 개발하고 있습니다로, 요즘 특히 유망 자기 안내 / 보존을위한 기초를 제공한다. 또, 얻어진 자기 응답 세포가 될 가능성이있는 비 침습적으로 자기 공명 영상 (MRI) 또는 자기 입자 이미지 (11) (12)에 의해 모니터링.

PEI는 / MNP 벡터의 경우에, 폴리아민은 분해 인자로부터 핵산 축합 따라서 보호를 보장 의, 세포에서 벡터의 국제화 및 엔도 좀은 5 탈출. MNPS 자기 유도의 관점에서뿐만 아니라, 공지 된 PEI 중독 7, 13, 14을 감소시킴으로써뿐만 아니라, PEI의 특성을 보완. 이전 PEI / MNP 벡터 성질은 섬유 아세포와 인간 중간 엽 줄기 세포 (15, 16)를 사용하여 전달 효율 (즉,과의 pDNA의 miRNA) 및 안전성의 관점에서 조정 하였다.

이 논문에서 miRNA의 변성 세포의 발생에 대한 PEI / MNPS의 애플리케이션에 대한 상세한 프로토콜은 17을 설명한다. 이를 위해, HUVECs를 사용하고 체외 혈관 신생에 대한 확립 된 모델을 나타내고있다. 그들은 형질에 도전하고 독성 영향 (18), (19)에 취약엉덩이 = "외부 참조"> 20. 또한, 우리는 그들의 타겟팅, 세포 간 통신 및 MRI 탐지를 포함하여 체외에서 이러한 세포를 평가하는 알고리즘을 제공한다.

Protocol

세포 분리를위한 인간 탯줄은 헬싱키 선언에 따라 연구를 위해이 물질의 사용에 자신의 서면 동의를 준 통보, 건강한 여성에서 분만을 얻었다. 로스 토크 대학의 윤리위원회는 제시된 연구 (REG. 호 2011 년 6 장기간 2013년 9월 23일)를 승인했다. 형질 착물의 제조 1 폴리에틸렌 이민의 바이오 티 닐화 (PEI). 300에서 자기 교반하에 초순수에 용해 지형 PEI – 실온…

Representative Results

제안 된 프로토콜의 주요 목적은 자기 반응은 miR-수정 세포를 생산하기 위해 자신의 정확한 특성 (그림 1)을 수행하는 것입니다. 따라서, MRI 자기장으로 선택하고 안내 및 검출 응답을 효율적으로 형질 감염된 세포를 수득한다. 먼저, 절연 된 HUVEC의 신원은 내피 세포 마커 CD31 전형적인 염색 (PECAM) (도 2a)에</s…

Discussion

상기 자기 자신의 제어 지침 상자성 나노로드 유 전적으로 조작 된 세포의 제조는 현재의 프로토콜에 제공된다. 이 전략의 성공적인 응용 프로그램은 이식에 대한 타겟팅 전지 제품을 제공함으로써, 같은 부상 영역 2, 3, 4, 낮은 유지와 가난한 생착 등 세포 치료의 어려움의 해결을 위해 수 있습니다. 또한, 적절히 선택…

Disclosures

The authors have nothing to disclose.

Acknowledgements

우리는 필터링 된 초상 자성 나노 입자의 TEM 이미지를 획득과 자신의 X 선 분석을 수행하기에 기술 지원을위한 G. 풀다 (전자 현미경 센터, 로스 토크 대학, 독일)에 감사드립니다. RTC 로스 토크에서 수행 작업은 연방 교육 연구부 독일 (FKZ 0312138A, FKZ 316159 및 VIP + 03VP00241) 및 EU 구조 기금과 국가 메 클렌 부르크 – 서쪽 포메 라니아 (ESF / IV-WM-B34-에 의해 지원되었다 0030/10와 ESF / IV-BM-B35-0010 / 12) 및 DFG (DA 1296-1), 축축한 재단 및 독일 심장 재단 (F는 / 01 / 12)에 의해. 프랭크 위호스트 EU FP7 연구 프로그램 "Nanomag"FP7-NMP-2013-LARGE-7에 의해 지원되었다.

Materials

PEI 25 kDa Sigma Aldrich 408727
EZ-Link Sulfo-NHS-LC-Biotin Thermo Scientific 21335
PD-10 Desalting Columns GE Healthcare 17085101 Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2% Sigma Aldrich 7285
Glycine Sigma Aldrich 410225
Pierce Biotin Quantitation Kit Thermo Scientific 28005
 Microplate reader Model 680 Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles Promega Z5481
Millex-HV PVDF Filter Merck SLHV013SL 0.45µm
Libra 120 transmission electron microscope  Zeiss Acceleration Voltage 120KV
Sapphire X-ray detector EDAX-Amatek
Cell culture plastic TPP
NHS-Esther Atto 565 ATTO-TEC GmbH AD 565-31
NHS-Esther Atto 488  ATTO-TEC GmbH AD 488-31
Cy5 miRNA Label IT kit Mirus Bio MIR 9650
Biotin Atto 565 ATTO-TEC GmbH AD 565-71
Collagense Type IV Gibco Thermo Scientific 17104019
Endothelial growth medium, EGM-2 Lonza CC-3156 & CC-4176
Penicillin/Streptomycin Thermo Scientific 15140122 100 U/ml, 100µg/ml
Matrigel BD Biosciences 356234
anti-PECAM-1 antibody Santa Cruz sc-1506
MS MACS columns Miltenyi Biotec  130-042-201
Near-IR Live/Dead Cell Stain Kit Thermo Scientific L10119
Cy3 Dye-Labeled Pre-miR Negative Control Thermo Scientific AM17120 "Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules – Negative Control  Thermo Scientific AM17110 "scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor  Thermo Scientific AM10916
LSM 780 ELYRA PS.1 system Zeiss
Paraformaldehyde Sigma Aldrich 158127 4% solution in PBS
DAPI nuclear stain Thermo Scientific D1306
NucleoSpin RNA isolation Kit Machery-Nagel 740955
mirVana miRNA Isolation Kit Thermo Scientific AM1560
TaqMan MicroRNA Reverse Transcription Kit Thermo Scientific 4366596
StepOnePlus Real-Time PCR System Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814
hsa-miR-92a TaqMan assay Thermo Scientific 000431 Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix Nippon Genetics LS27
ITGA5 TaqMan assay Thermo Scientific Hs01547673_m1
RNU6B TaqMan assay Thermo Scientific 001093
18S rRNA Endogenous Control Thermo Scientific 4333760F
Gelatin Sigma Aldrich G7041
CellTrace Calcein Red-Orange Thermo Scientific C34851
PBS Pan Biotech P04-53500
BSA Sigma Aldrich
MACS buffer Miltenyi Biotec  130-091-221
Agarose Sigma Aldrich A9539
7.1 Tesla animal MRI system Bruker Corporation A7906
ImageJ software National Institutes of Health upgraded with an AngiogenesisAnalyzer (NIH)
MPS device Bruker Biospin
Matlab software Mathworks
Ring Neodym Magnet  magnets4you GmbH RM-10x04x05-G ø 10 mm; remanescence is ~1.3T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit Thermo Scientific C10340
FluorSave Reagent Merck 345789
Ultrasonic bath Bandelin electronic Type: RK 100 SH
DOWNLOAD MATERIALS LIST

References

  1. Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11 (4), 232-246 (2014).
  2. Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115 (14), 1866-1875 (2007).
  3. Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4 (2), 177-181 (2011).
  4. Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54 (17), 1619-1626 (2009).
  5. Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy – Principles and Challenges. , (2015).
  6. Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
  7. Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15 (8), 541-555 (2014).
  8. Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6 (31), 30675-30703 (2015).
  9. Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10 (8), 897-909 (2008).
  10. Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
  11. Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6 (3), 291-301 (2016).
  12. Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5 (7), 667-685 (2015).
  13. Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. , (2016).
  14. Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
  15. Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14 (6), 10710-10726 (2013).
  16. Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9 (7), 999-1017 (2014).
  17. Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12 (8), 2353-2364 (2016).
  18. Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21 (2), 66-72 (2010).
  19. Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35 (27), 7909-7918 (2014).
  20. Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91 (2), 223-227 (2012).
  21. Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211 (2), 907-913 (1954).
  22. Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34 (12), 1893-1902 (2002).
  23. Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8 (1), 28-40 (2001).
  24. Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
  25. Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
  26. Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89 (1), 41-48 (2012).
  27. Andrade, &. #. 1. 9. 4. ;. L., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324 (10), 1753-1757 (2012).
  28. Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10 (4), e0123159 (2015).
  29. Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32 (35), 9218-9230 (2011).
  30. Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
  31. Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324 (5935), 1710-1713 (2009).
  32. Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15 (9), 1989-1998 (2011).
  33. Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
  34. Cheng, K., Li, T. -. S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106 (10), 1570-1581 (2010).
  35. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. , A.3B.1-A.3B.2 (2001).
  36. Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29 (5), 1232-1241 (2012).
  37. Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12 (2), 337-346 (2016).
  38. Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8 (5), 1-10 (2013).
  39. Hernando, D., Kühn, J. -. P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37 (3), 717-726 (2013).
  40. Soenen, S. J., Rivera-Gil, P., Montenegro, J. -. M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6 (5), 446-465 (2011).
  41. Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27 (3), 85 (2008).
  42. Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
  43. Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
  44. Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
  45. Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
  46. Chen, C. -. H., Sereti, K. -. I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19 (8), 1757-1772 (2015).
  47. Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16 (10), 2413-2421 (2012).
  48. Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9 (23), 4017-4026 (2013).
  49. Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10 (1), 225-234 (2014).
  50. Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2 (8), 794-802 (2009).
  51. Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4 (6), 149 (2013).
  52. Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
  53. Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6 (7), 832-842 (2010).
  54. Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21 (6), 1121-1135 (2012).
  55. Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35 (30), 8528-8539 (2014).

Tags

Magnetized CellsMiR-modified CellsEndothelial CellsCell MagnetizationMicroRNA TransfectionPolyethyleneimeneSuper Paramagnetic Iron Oxide NanoparticlesCell TherapyRegenerative MedicineCell RetentionCell SurvivalConfocal MicroscopyStructured Illumination Microscopy
check_url/kr/55567?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Voronina, N., Lemcke, H., Wiekhorst, F., Kühn, J., Frank, M., Steinhoff, G., David, R. Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells. J. Vis. Exp. (123), e55567, doi:10.3791/55567 (2017).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image