Rekombinant Protein Ekspression, Krystallisering og Biofysiske Studier af a<em> Bacillus</em> -konserveret nucleotidpyrophosphorylase, BcMazG
Summary
Bacillus anthracis er det obligatoriske patogen af dødelig inhalationsbrandbrand, så undersøgelser af dets gener og proteiner er strengt regulerede. En alternativ tilgang er at studere orthologe gener. Vi beskriver biofysikologiske undersøgelser af en B. anthracis ortholog i B. cereus , bc1531, der kræver minimal eksperimentelt udstyr og mangler alvorlige sikkerhedshensyn.
Abstract
For at overvinde sikkerhedsrestriktioner og forskrifter når man studerer gener og proteiner fra ægte patogener, kan deres homologer undersøges. Bacillus anthracis er et obligatorisk patogen, som forårsager dødelig inhalationsbrandbrand. Bacillus cereus betragtes som en nyttig model til at studere B. antracis på grund af dens nære evolutionære forhold. Genklyngen ba1554 – ba1558 af B. anthracis er stærkt bevaret med bc1531 – bc1535- klyngen i B. cereus , såvel som med bt1364-bt1368- klyngen i Bacillus thuringiensis, der angiver den kritiske rolle af de associerede gener i Bacillus- slægten. Dette manuskript beskriver metoder til fremstilling og karakterisering af et proteinprodukt fra det første gen ( ba1554 ) fra genklyngen i B. anthracis ved anvendelse af et rekombinant protein af dets ortholog i B. cereus , bc1531.
Introduction
Rekombinant proteinekspression anvendes i vid udstrækning til at overvinde problemer forbundet med naturlige proteinkilder, såsom begrænsede proteinmængder og skadelig forurening. Desuden kan i en undersøgelse af patogene gener og proteiner anvendes en alternativ laboratoriestamme, der ikke kræver yderligere sikkerhedsforanstaltninger. For eksempel er Bacillus cereus en nyttig model til at studere Bacillus anthracis på grund af deres nære evolutionære forhold 1 .
B. anthracis er et obligatorisk patogen, der forårsager dødelig inhalationsantrax hos mennesker og husdyr og kan potentielt anvendes som bioweapon 2 . Således er laboratorieundersøgelser af B. anthracis strengt reguleret af de amerikanske centre for sygdomsbekæmpelse, der kræver biosikkerhedsniveau 3 (BSL-3) praksis, som pålægger laboratorieområdet at blive adskilt med negativt rumtryk. I modsætning til B. anthracis </eM>, B. cereus er kategoriseret som et BSL-1-middel og har således mindste sikkerhedsproblemer. B. cereus er et opportunistisk patogen, der ved infektion forårsager fødeforgiftning, der kan behandles uden medicinsk hjælp. Men fordi B. cereus deler mange kritiske gener med B. antracis , kan funktionerne af B. anthracis proteiner studeres under anvendelse af de tilsvarende homologer af B. cereus 1 .
Ba1554 – ba1558 genklyngen af B. anthracis er stærkt bevaret med bc1531 – bc1535 klyngen Af B. cereus , såvel som med bt1364-bt1368- klyngen af Bacillus thuringiensis , hvad angår genorganisation og sekvens. Desuden er de første gener ( ba1554 , bc1531 og bt1364 ) af de respektive klynger absolut bevaret ( dvs. 100% nukleotidsekvensidentitet), implicitNg en kritisk rolle for genproduktet i Bacillus- arten. På grund af sin placering i disse genklynger var ba1554 fejlagtigt som en formodet transkriptionsregulator 3 . Imidlertid viser aminosyresekvensanalyse af ba1554- produktet, at det tilhører MazG-familien, som har nukleotidpyrophosphohydrolaseaktivitet og ikke er forbundet med transkriptionsfaktoraktivitet 4 , 5 . Selv om proteiner tilhørende MazG-familien er forskellige med hensyn til den samlede sekvens og længde, deler de et fælles MazG-domæne med 100 rester, der er kendetegnet ved et EXXE 12-28 EXXD-motiv ("X" står for en hvilken som helst aminosyrerest, og tallet Angiver antallet af X rester).
MazG-domænet er ikke altid direkte ansvarlig for en bestemt katalytisk aktivitet. Et MazG-medlem fra Escherichia coli (EcMazG) besidder to MazG-domæner, men påDet C-terminale MazG-domæne er enzymatisk aktivt 6 . Desuden varierer substratspecificiteten af MazG-enzymer fra ikke-specifikke nucleosidtrifosfater (til EcMazG) til specifik dCTP / dATP (for integrin-associeret MazG) og dUTP (til dUTPaser) 6 , 7 , 8 , 9 . Derfor er biofysisk-kemiske analyser af BA1554-proteinet nødvendige for at bekræfte dets NTPase-aktivitet og at dechiffrere dets substratspecificitet.
Her tilvejebringer vi en trin-for-trin protokol, som de fleste laboratorier uden et BSL-3-anlæg kan følge for at karakterisere proteinproduktet fra B. cereus bc1531 genet, som er en ortholog af B. anthracis ba1554 , på molekylær niveau. Kort fortalt blev rekombinant BC1531 (rBC1531) udtrykt i E. coli og oprenset ved anvendelse af en affinitetsmærke. Til røntgenkrystalliske eksperimenter, krystalliseresZationbetingelser for rBC1531-proteinet blev screenet og optimeret. For at vurdere den enzymatiske aktivitet af rBC1531 blev NTPase-aktivitet overvåget kolorimetrisk for at undgå radioaktivt mærket nukleotider, der er blevet anvendt konventionelt. Endelig gjorde analyser af de opnåede biofysikologiske data os i stand til at bestemme oligomeriseringstilstanden og katalytiske parametre for rBC1531 såvel som at opnå røntgendiffraktionsdata fra rBC1531-krystallen.
Protocol
Representative Results
Discussion
Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Røntgendiffraktionsdatasætene blev opsamlet ved beamline 7A i Pohang Accelerator Laboratory (Korea). Denne undersøgelse blev støttet af Basic Science Research Programmet administreret gennem Koreas National Research Foundation (NRF), finansieret af Ministeriet for Videnskab, IKT og fremtidig planlægning (2015R1A1A01057574 til MH).
Materials
| Bacillus cereus ATCC14579 | Korean Collection for Tissue Culture | 3624 | |
| Genomic DNA prep kit | GeneAll | 106-101 | Genomic DNA preparation |
| Forward primer | Macrogen | GAAGGATCCGGAAGCAAAAA CGATGAAAGATATGCA |
BamHI site is underlined |
| Reverse primer | Macrogen | CTTGTCGACTTATTCTTTCTCT CCCTCATCAATACGTG |
SalI site is underlined |
| nPfu-Forte | Enzynomics | P410 | PCR polymerase |
| BamHI | Enzynomics | R003S | |
| SalI | Enzynomics | R009S | |
| pET49b expression vector | Novagen | 71463 | Expression vector was modified to add affinity tags and BamHI/SalI sites10 |
| T4 DNA ligase | Enzynomics | M001S | |
| Dialysis memebrane | Thermofisher | 18265017 | |
| Dry block heater | JSR | JSBL-02T | |
| LB broth (Luria-Bertani) | LPS solution | LB-05 | |
| LB Agar, Miller (Luria-Bertani) | Becton, Dickinson and Company | ||
| Kanamycin | LPS solution | KAN025 | |
| Mini-prep kit | Favorgen | FAPDE300 | Plasmid DNA preparation |
| BL21(DE3) Competent cell | Novagen | 69450-3CN | |
| Isopropyl β-D-1-thiogalactopyranoside (IPTG) | Fisher BioReagents | 50-213-378 | |
| Sodium chloride | Daejung | 7548-4100 | PBS material |
| Potassium chloride | Daejung | 6566-4405 | PBS material |
| Potassium phosphate | Bio Basic Inc | PB0445 | PBS material |
| Sodium phosphate | Bio Basic Inc | S0404 | PBS material |
| Imidazole | Bio Basic Inc | IB0277 | |
| Sonicator | Sonics | VCX 130 | |
| Ni-NTA agaros | Qiagen | 30210 | Nickel bead |
| Rotator | Finepcr | AG | |
| Precision Plus Protein Dual Color Standards | Bio-rad | 1610374 | SDS-PAGE protein standard |
| Coonmassie Brilliant Blue R-250 | Fisher BioReagents | BP101-25 | Coomassie staining solution |
| Methyl alcohol | Samchun chemical | M0585 | Coomassie staining solution |
| Acetic acid | Daejung | 1002-4105 | Coomassie staining solution |
| Dialysis memebrane | Thermofisher | 68035 | |
| 2-Mercaptoethanol | Sigma-aldrich | M6250 | |
| Thrombin | Merckmillipore | 605157-1KUCN | Prepare aliquots of 20 μl (1 Unit per μl) and store at 70 °C and thaw before use |
| Superdex 200 16/600 | General Electric | 28989335 | Size exclusion chromatography |
| Gel filtration standard | Bio-rad | 151-1901 | |
| Centrifugal filter | Amicon | UFC800396 | |
| Crystralization plates | Hampton research | HR3-083 | 96-well sitting drop plate |
| The JCSG core suite I-IV | Qiagen | 130924-130927 | Crystallization secreening solution |
| Microscope | Nikon | SMZ745T | |
| Cryschem plates | Hampton research | HR3-158 | 24-well sitting drop plate |
| Inorganic pyrophosphatase | Sigma | 10108987001 | |
| Ammonium molybdate solution | Sigma | 13106-76-8 | |
| L-ascorbic acid | Sigma | 50-81-7 | |
| NTP substrate | Startagene | 200415-51 | |
| Spectrophotometer | Biotek | SynergyH1 | microplate reader |
| GraphPad Prism 5 | GraphPad | Prism 5 for Window |
References
- Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
- Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
- Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
- Gross, M., Marianovsky, I., Glaser, G. MazG — a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
- Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
- Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
- Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
- Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
- Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
- Green, M., Sambrook, J. . Molecular cloning: A laboratory Manual. 1, (2012).
- Brown, T. A. . Gene cloning an introduction. , (1986).
- Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
- Sheehan, D. . Physical biochemistry: Principles and applications. , (2009).
- Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
- Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
