Het bestuderen van celcyclusreguleerde genuitdrukking door twee complementaire celsynchronisatieprotocollen
Summary
We rapporteren twee celsynchronisatieprotocollen die een context bieden voor het bestuderen van gebeurtenissen die verband houden met specifieke fasen van de celcyclus. We tonen aan dat deze aanpak nuttig is voor het analyseren van de regulering van specifieke genen in een ongeblokkeerde celcyclus of bij blootstelling aan agens die de celcyclus beïnvloeden.
Abstract
Het genuitdrukkingsprogramma van de celcyclus is een kritische stap voor het begrijpen van celcyclusafhankelijke processen en hun rol in ziekten zoals kanker. Celcyclus-gereguleerde genexpressie analyse hangt van celsynchronisatie in specifieke fasen af. Hier beschrijven we een methode die gebruik maakt van twee complementaire synchronisatieprotocollen die vaak gebruikt worden voor het bestuderen van periodieke variatie van genuitdrukking tijdens de celcyclus. Beide procedures zijn gebaseerd op het voorbijgaande blokkeren van de celcyclus in een bepaald punt. Het synchronisatieprotocol door hydroxyurea (HU) -behandeling leidt tot cellulaire arrestatie in de late G1 / early S-fase, en vrijlating van HU-gemedieerde arrestatie zorgt ervoor dat een cellulaire populatie uniform door S en G2 / M vordert. Het synchronisatieprotocol door thymidine en nocodazol (Thy-Noc) behandeling blokkeert cellen in de vroege mitose, en vrijlating uit Thy-Noc gemedieerde arrestatie levert een gesynchroniseerde cellulaire populatie geschikt voor G1 fase en S fase-enProbeer studies. Toepassing van beide procedures vereist het controleren van de celcyclusverdelingsprofielen, die typisch worden uitgevoerd na propidiumjodide (PI) kleuring van de cellen en flowcytometrie gemedieerde analyse van DNA-inhoud. We laten zien dat het gecombineerde gebruik van twee synchronisatieprotocollen een robuuste aanpak is om de transcriptieprofielen van genen die in de celcyclus anders gereguleerd zijn, duidelijk te bepalen ( dwz E2F1 en E2F7) en dus beter inzicht te krijgen in hun rol in celcyclus processen. Verder tonen wij aan dat deze aanpak nuttig is voor het bestuderen van mechanismen die gebaseerd zijn op geneesmiddelen gebaseerde therapieën ( dwz mitomycine C, een anticancer agent), omdat het het mogelijk maakt genen die reageren op het genotoxische middel te discrimineren van diegenen die alleen door celcyclusverstoringen worden beïnvloed Opgelegd door de agent.
Introduction
Overgang door alle fasen van de celcyclus wordt gekoppeld aan een strak gereguleerd genuitdrukkingsprogramma. Deze gecoördineerde "aan en uit" van gentranscriptie gedurende de celcyclus wordt geacht onder controle te zijn van complexe transcriptie regulerende systemen, die niet alleen de timing reguleren, maar ook de niveaus van genuitdrukking. Deregulatie van belangrijke celcycluscomponenten is bekend om bij te dragen tot de ontwikkeling van verschillende aandoeningen en is een goed gevestigd kenmerk van tumorigenese 1 , 2 . Genoom-brede transcriptomische analyses uitgevoerd in gist- en zoogdiercellen hebben aangetoond dat een groot aantal genen periodieke genuitdrukkingspatronen in de celcyclus vertoont, wat aangeeft dat transcriptieve fluctuaties tijdens de celcyclus een afspiegeling vormen van de tijdelijke vereiste van een gegeven genproduct In een precieze fase 3 , 4 , </suP> 5 .
Een belangrijke taak in de studie van celcyclusreguleerde genuitdrukking is de synchronisatie van cellen in specifieke celcyclusfasen. Cellsynchronisatie helpt de associatie van een genuitdrukkingspatroon te interpreteren met een bepaalde cyclusfaseovergang, en het heeft geleid tot een beter inzicht in de regulering en functie van talrijke genen. Cellsynchronisatie is ook belangrijk voor het bestuderen van het werkingsmechanisme van anticancermiddelen, omdat chemotherapeutische middelen bekend zijn om zowel de genuitdrukking als de celcycluskinetiek 6 , 7 te beïnvloeden. Niettemin is het vaak moeilijk om te bepalen of genuitdrukkingsverschillen die voortvloeien uit de behandeling met deze middelen een directe reactie op de behandeling zijn of gewoon het gevolg zijn van veranderingen in celcyclusprofielen. Om te onderscheiden tussen deze mogelijkheden, moet genuitdrukking worden geanalyseerd in cellen die s zijn geweestGechronchroniseerd voorafgaand aan toevoeging van het chemotherapeutische geneesmiddel.
Met uitzondering van enkele primaire cellen, zoals vers geïsoleerde lymfoïde cellen, die een homogene celpopulatie vormen die gesynchroniseerd zijn in G08, groeien in vitro gevestigde cellijnen asynchroon in cultuur. Onder regelmatige groeivoorwaarden worden deze asynchrone cyclische cellen gevonden in alle fasen van de celcyclus, maar bij voorkeur in G1 9 . Daarom biedt deze context geen optimaal scenario voor functionele of genexpressieanalyses in een specifieke celcyclusfase (bijvoorbeeld G1, S, enz.). Niet-getransformeerde immortalized cellijnen ( bijv. Fibroblasten) kunnen worden gesynchroniseerd met zogenaamde fysiologische methoden 10 . Deze methoden zijn gebaseerd op de bewaarde primaire celkenmerken van niet-getransformeerde cellen, zoals celcontact remming en afhankelijkheid van de groeifactor om verder te gaan fietsen. VerwijderingVan serum in combinatie met contactinhibitie maakt niet-getransformeerde cellen gearresteerd bij G0 / G1. Echter, de gesynchroniseerde celcyclusinvoer en de progressie vereisen vaak subcultuur, die ook kunstmatige loslating van de cellen inhoudt en opnieuw opbouwt 10 . Belangrijker nog, deze methode is niet geschikt voor synchronisatie van getransformeerde cellijnen, de overgrote meerderheid van gevestigde cellijnen die momenteel in gebruik zijn, gekenmerkt door het ontbreken van celcontact gemedieerde groei remming of respons op groeifactor onttrekking. Zo is het duidelijk dat alternatieve methoden nodig zijn voor efficiënte celsynchronisatie in specifieke fasen van de celcyclus. In het algemeen zijn de meest gebruikte synchronisatiemethoden gebaseerd op transiënte chemische of farmacologische remming van een bepaald punt van de celcyclus, typisch DNA synthese of mitotische spindelvorming. Inhibitie van DNA-synthese synchroniseert cellen door ze in de late G1 of vroege S-fase te arresteren. Dit kan achi zijnDoor middel van toevoeging van verbindingen zoals mimosine, een inhibitor van nucleotidebiosynthese 11 , 12 , aphidicoline, een inhibitor van DNA-polymerasen 13 , 14 , hydroxyureum, een inhibitor van ribonucleotide reductase 15 , 16 of door overmaat hoeveelheden thymidine 17 , 18 . Aan de andere kant kunnen remmers van microtubule-polymerisatie, zoals colchicine of nocodazol, de mitotische spindelvorming blokkeren, wat leidt tot cellynchronisatie in de vroege M-fase 19 , 20 , 21 .
In dit werk beschrijven wij een methode waarbij twee complementaire synchronisatieprotocollen zijn gebaseerd op transiënte chemische remming voor het bestuderen van de expressie van celcyclusreguleerde genen bij het mRNAniveau. Deze methode is essentieel voor het bepalen van de rol van celcyclusgenen in specifieke celcyclusprocessen. Bovendien biedt het een algemeen kader voor het bestuderen van de impact van anticancerbehandelingen om nauwkeurig medicijnresponsieve genen te detecteren en misinterpretaties af te leiden die zijn afgeleid van verstoringen in de celcyclusprogressie die door deze medicijnen wordt gegenereerd.
Protocol
Representative Results
Discussion
Analyse van fine-tuned gereguleerde genen die betrokken zijn bij transiënte en specifieke rollen in de celcyclus vereist een uniforme celpopulatie. Veel onderzoekers gebruiken hiervoor langdurige tumorcellijnen voor deze doeleinden, en een verscheidenheid aan methoden zijn ontwikkeld om synchrone (of gedeeltelijk synchrone) celpopulaties te verkrijgen, met het doel om zoveel mogelijk cellen op te bouwen in gedefinieerde celcyclusfasen. Bovendien zijn er veel inspanningen geleverd om de gevestigde synchronisatiebenaderi…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Wij danken de leden van de Zubiaga en de Altmeyer laboratoria voor hulpvaardige discussies en voor technische ondersteuning. Dit werk werd ondersteund door subsidies van het Spaanse ministerie (SAF2015-67562-R, MINECO / FEDER, UE), de Baskische regering (IT634-13 en KK-2015/89) en de Universiteit van Baskenland UPV / EHU UFI11 / 20).
Materials
| DMEM, high glucose, GutaMAX supplement | Thermo Fisher Scientific | 61965-059 | |
| FBS, qualified, E.U.-approved, South America origin | Thermo Fisher Scientific | 10270-106 | |
| Penicillin-Streptomycin (10,000 U/mL) | Thermo Fisher Scientific | 15140-122 | |
| 0.25% Trypsin-EDTA (1X), phenol red | Thermo Fisher Scientific | 25200-072 | |
| Thymidine | SIGMA | T1895-5G | Freshly prepared. Slight warming might help dissolve thymidine. |
| Nocodazole | SIGMA | M-1404 | Stock solution in DMSO stored at -20 ºC in small aliquots |
| Hydroxyurea | SIGMA | H8627 | Freshly prepared |
| Mitomycin C from Streptomyces caespitosus | SIGMA | M4287 | 1.5mM stock solution in sterile H2O protected from light and stored at 4ºC |
| Dimethyl sulfoxide | SIGMA | D2650 | |
| Propidium iodide | SIGMA | P4170 | Stock solution in sterile PBS at 5 mg/ml, stored at 4º C protected from light. |
| PBS pH 7.6 | Home made | ||
| Ethanol | PANREAC | A3678,2500 | |
| Chloroform | SIGMA | C2432 | |
| Sodium Citrate | PANREAC | 131655 | |
| Triton X-100 | SIGMA | T8787 | |
| RNAse A | Thermo Fisher Scientific | EN0531 | |
| TRIzol Reagent | LifeTechnologies | 15596018 | |
| RNeasy Mini kit | QIAGEN | 74106 | |
| High-Capacity cDNA Reverse Transcription Kit | Thermo Fisher Scientific | 4368814 | |
| Anti-Cyclin E1 antibody | Cell Signaling | 4129 | 1:1000 dilution in 5% milk, o/n, 4 ºC |
| Anti-Cyclin B1 antibody | Cell Signaling | 4135 | 1:1000 dilution in 5% milk, o/n, 4 ºC |
| Anti-β-actin | SIGMA | A-5441 | 1:3000 dilution in 5 % milk, 1 hr, RT |
| Anti-pH3 (Ser 10) antiboty | Millipore | 06-570 | Specified in the protocol |
| Secondary anti-rabbit AlexaFluor 488 antibody | Invitrogen | R37116 | Specified in the protocol |
| Secondary anti-mouse-HRP antibody | Santa Cruz Biotechnology | sc-3697 | 1:3000 dilution in 5 % milk, 1 hr, RT |
| Forward E2F1 antibody (human) TGACATCACCAACGTCCTTGA | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Reverse E2F1 antibody (human) CTGTGCGAGGTCCTGGGTC | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward E2F7 antibody (human) GGAAAGGCAACAGCAAACTCT | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Reverse E2F7 antibody (human) TGGGAGAGCACCAAGAGTAGAAGA | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward p21Cip1 antibody (human) AGCAGAGGAAGACCATGTGGAC | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Reverse p21Cip1 antibody (human) TTTCGACCCTGAGAGTCTCCAG | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward TBP antibody (human) reference gene | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Reverse TBP antibody (human) | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward Oxa1L antibody (human) reference gene CACTTGCCAGAGATCCAGAAG | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Reverse Oxa1L antibody (human) CACAGGGAGAATGAGAGGTTTATAG | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Power SYBRGreen PCR Master Mix | Thermo Fisher Scientific | 4368702 | |
| FACS Tubes | Sarstedt | 551578 | |
| MicroAmp Optical 96-Well Reaction Plate | Thermo Fisher Scientific | N8010560 | |
| Corning 100mm TC-Treated Culture Dish | Corning | ||
| Corning Costar cell culture plates 6 well | Corning | 3506 | |
| Refrigerated Bench-Top Microcentrifuge | Eppendorf | 5415 R | |
| Refrigerated Bench-Top Centrifuge Jouan CR3.12 | Jouan | 743205604 | |
| NanoDrop Lite Spectrophotometer | Thermo Scientific | ND-LITE-PR | |
| BD FACSCalibur Flow Cytometer | BD Bioscience | ||
| QuantStudio 3 Real-Time PCR System | Thermo Fisher Scientific | A28567 |
References
- Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101 (4), 1220-1235 (2003).
- Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9 (11), 785-797 (2009).
- Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27 (1), 48-54 (2001).
- Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41 (5), 2846-2856 (2013).
- Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24 (23), 3634-3650 (2013).
- Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4 (6), 885-900 (2005).
- McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11 (16), 3132-3140 (2012).
- Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7 (24), 3915-3927 (2008).
- Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
- Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41 (2), 143-150 (2007).
- Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186 (2), 332-339 (1990).
- Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11 (4), 761-766 (2012).
- Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275 (5679), 458-460 (1978).
- Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42 (22), 14013-14021 (2014).
- Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242 (6), 1314-1317 (1967).
- Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. , (2016).
- Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
- Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
- Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
- Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126 (2), 397-405 (1980).
- Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91 (5), 413-419 (2012).
- Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1 (3), 1559-1582 (2006).
- Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39 (2), 145-154 (2011).
- Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9 (6), 400-414 (2009).
- Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).
- Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
- Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217 (2), 546-553 (1995).
- Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23 (23), 4615-4626 (2004).
- Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20 (1), 1-9 (2009).
- Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
- Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5 (1), 37-42 (1975).
- Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13 (6), 1977-2000 (2002).
- Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140 (15), 3079-3093 (2013).
- Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30 (1), 83-89 (2006).
- Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372 (2), 181-194 (1996).
- Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23 (1), 259-268 (2011).
- Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289 (9), 5730-5746 (2014).
- Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246 (4930), 629-634 (1989).
- St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29 (8), 2068-2081 (2009).
- Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12 (6), 865-877 (2013).
