체외 전사 mRNA를 가진 1 차적인 대식세포의 고효율 형질감염
Summary
대식세포, 특히 1차 대식세포는 비자기 기원의 분자를 검출하는 것을 전문으로 하기 때문에 트랜스펙트에 도전하고 있습니다. 우리는 플라스미드와 같은 DNA 템플릿에서 생성된 mRNA를 가진 1 차적인 대식세포의 고도로 능률적인 형질혈을 허용하는 프로토콜을 기술합니다.
Abstract
대식세포는 비자기 기원의 분자를 검출하는 것을 전문화한 식세포이다. 이를 위해, 이들은 대량의 패턴 인식 수용체(PRR)를 구비한다. 불행하게도, 이것은 또한 형질전환 시약 및 형질감염된 핵산이 종종 PRR에 의해 비 자기로 인식되기 때문에 형질전환에 특히 도전하게 한다. 따라서 형질감염은 종종 형질감염된 핵산의 활성화 및 분해를 초래하거나 대식세포의 자살에도 초래한다. 여기에서, 우리는 복막 대식세포 (PM) 및 골수 파생 대식세포 (BMDM)와 같은 min의 1 차적인 대식세포의 고도로 능률적인 형질감염을 허용하는 프로토콜을 말합니다. 이 간단한 프로토콜을 사용하면 PM에 대해 약 50-65 %의 형질 감염 비율과 BMDM에 대한 약 85 %가 세포 독성 또는 면역 원성 관찰없이 달성됩니다. 우리는 플라스미드 및 형질전환 절차와 같은 DNA 구조에서 형질전환에 대한 mRNA의 생성을 상세히 기술한다.
Introduction
대식세포는 미생물, 세포 사멸 세포 및 세포 파편을 검출, 섭취 및 분해하는 것을 전문으로 하는 식세포입니다. 또한, 그들은 사이토 카인과 케모카인을 분비하고 T 세포와 B 세포에 항원을 제시하여 면역 반응을 조율하는 데 도움이됩니다. 대식세포는 또한 상처 치유, 동맥 경화증, 종양 발생 및 비만과 같은 수많은 다른 프로세스에서 중요한 역할을 합니다.
병원체 관련 분자 패턴(PAMPs) 및 손상 관련 분자 패턴(DAMPs)과 같은 비자기 분자를 검출할 수 있도록 대식세포는 광범위한 패턴 인식 수용체(PRR)를구비한다. 불행하게도, 이것은 또한 형질감염 시약3 및 형질감염된 핵산4,5,6,7이 종종 PR에 의해 비자기로 인식됨에 따라2를 트랜스펙트하는 데 특히 도전적이다. 이러한 이유로, 화학적 또는 물리적방법을 이용한 대식세포의 형질감염8은 일반적으로 형질감염된 핵산의 활성화 및 분해를 초래하거나, 심지어 는 DNA 또는 외국 RNA9와같은 세포질 PAMPs/DAMPs의 인식 후에 촉발된 프로그램된 라이틱 세포 사멸의 한 형태인 형광핵산을 일으킨다. 벡터로서 아데노바이러스 또는 렌티바이러스와 같은 바이러스를 이용한 대식세포의 생물학적 형질감염은 종종 더 효율적이지만, 이러한 바이러스 벡터의 시공은 시간이 많이 소요되고 생체 안전수준 2장비(10,11)가필요하다.
따라서, 대식세포는 집중적인 연구의 대상이지만, 분자 생물학의 가장 중요한 도구 중 하나이기 때문에 분자 수준에서의 기능 분석은 방해를 받으며, 외인성 발현을 위한 핵산 구성물의 형질전환은 거의 적용되지 않습니다. 이것은 수시로 보나 선의의 대식세포 보다는 오히려 대식세포 같이 세포주를 사용하기 위하여 연구원을 강제로 합니다. 핵산 구성 형질전환을 위한 응용분야는 돌연변이 또는 태그가 지정된 단백질 버전의 발현, 특정 단백질의 과발현, 각각의 녹아웃 배경에서의 단백질 재발현 및 다른 종으로부터의 단백질의 발현(예를 들어)을 포함한다. , Cre 재조합 또는 표적 유전자 녹아웃을 위한 RNA 및 Cas9를 가이드한다.).
여기에서, 우리는 플라스미드와 같은 DNA 템플릿에서 생성된 mRNA를 가진 뮤린 맥이원 대식세포 (PM) 및 골수 유래 대식세포 (BMDM)의 고효율 형질감염을 허용하는 프로토콜을 기술합니다. 중요한 것은, 이 프로토콜을 사용하여 생성된 시험관내 전사 mRNA는 면역원성을 감소시키고 안정성을 향상시키는 자연발생적 변형된 뉴클레오시드 5-메틸-CTP 및 의사-UTP를 함유하고4,6,7,12,13. 더욱이, 시험관내 전사 mRNA의 5′-말단은 RIG-I 복합체14,15에의한 인식을 방지하기 위해 남극 인산염에 의해 탈인성된다. 이는 시험관내 전사 mRNA의 선천적인 면역 인식을 최소화한다. 프로토콜을 수행하기 쉬운 경우, 50-65 %(후막 대식세포 (PM)와 85 % (BMDM) 사이의 형질 감염 비율은 세포 독성 또는 면역 원성이 관찰되지 않는 동안 도달합니다. 우리는 (i) 형질감염에 대한 면역학적으로 침묵된 mRNA가 플라스미드 및 (ii) 형질전환 절차 자체와 같은 DNA 구조로부터 어떻게 생성될 수 있는지 상세히 설명한다.
Protocol
Representative Results
Discussion
여기에서 우리는 시험관 내 전사 mRNA를 가진 일반적으로 단단한 transfect 1 차 적인 대식세포의 고도로 능률적인 형질혈을 위한 프로토콜을 제시합니다. 중요한 것은, 이 프로토콜을 사용하는 대식세포의 형질감염은 세포 사멸을 유도하거나 형질감염 시약이나 형질감염된 mRNA가 비자기로 인식되지 않는다는 것을 나타내는 전염증성 신호를 활성화하지 않는다는 것이다.
mRNA의 ?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
이 작품은 도이치 포르충제마인샤프트(SFB 670)의 지원을 받았다.
Materials
| 5-methyl-CTP (100 mM) | Jena Biosience | NU-1138S | stored at -20 °C |
| Antarctic phosphatase | New England BioLabs | M0289 | stored at -20 °C |
| Antarctic phosphatase reaction buffer (10X) | New England BioLabs | B0289 | stored at -20 °C |
| anti-NEMO/IKKγ antibody | Invitrogen | MA1-41046 | stored at -20 °C |
| anti-β-actin antibody | Sigma-Aldrich | A2228 | stored at -20 °C |
| Petri dishes 92,16 mm with cams | Sarstedt | 821,473 | stored at RT |
| CD11b Microbeads mouse and human | Miltenyi Biotec | 130-049-601 | stored at 4 °C |
| Cre recombinase + T7-Promotor forward primer | Sigma-Aldrich | 5′-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3´, stored at -20 °C |
|
| Cre recombinase + T7-Promotor reverse primer | Sigma-Aldrich | 5′-CTAATCGCCATCTTCCAGCAGG C-3′, stored at -20 °C |
|
| DNA purification kit: QIAquick PCR purification Kit | Qiagen | 28104 | stored at RT |
| eGFP + T7-Promotor forward primer | Sigma-Aldrich | 5´-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3´, stored at -20 °C |
|
| eGFP + T7-Promotor reverse primer | Sigma-Aldrich | 5´-TGGTATGGCTGATTA TGATCTAGAGTCG-3´, stored at -20 °C |
|
| Fast Digest buffer (10X) | Thermo Scientific | B64 | stored at -20 °C |
| FastDigest XbaI | Thermo Scientific | FD0684 | stored at -20 °C |
| high-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase | New England Biolabs Inc | M0491S | stored at -20 °C |
| IKKβ + T7-Promotor forward primer | Sigma-Aldrich | 5′-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3′, stored at -20 °C |
|
| IKKβ + T7-Promotor reverse primer | Sigma-Aldrich | 5′-GAGGAAGCGAGAGCT-CCATCTG-3′, stored at -20 °C | |
| in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing) | New England BioLabs | E2060 | stored at -20 °C |
| LS Columns | Miltenyi Biotec | 130-042-401 | stored at RT |
| MACS MultiStand | Miltenyi Biotec | 130-042-303 | stored at RT |
| mRNA transfection buffer and reagent: jetMESSENGER | Polyplus transfection | 409-0001DE | stored at 4 °C |
| Mutant IKKβ IKK-2S177/181E plasmid | Addgene | 11105 | stored at -20 °C |
| Mutant NEMOC54/347A plasmid | Addgene | 27268 | stored at -20 °C |
| pEGFP-N3 plasmid | Addgene | 62043 | stored at -20 °C |
| poly(I:C) | Calbiochem | 528906 | stored at -20 °C |
| pPGK-Cre plasmid | F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 °C | ||
| pseudo-UTP (100 mM) | Jena Biosience | NU-1139S | stored at -20 °C |
| QuadroMACS Separator | Miltenyi Biotec | 130-090-976 | stored at RT |
| Rat-anti-mouse CD11b antibody, APC-conjugated | BioLegend | 101212 | stored at 4 °C |
| Rat-anti-mouse F4/80 antibody, PE-conjugated | eBioscience | 12-4801-82 | stored at 4 °C |
| recombinant M-CSF | Peprotech | 315-02 | stored at -20 °C |
| RNA purification kit: MEGAclear transcription clean-up kit | ThermoFisher Scientific | AM1908 | stored at 4 °C |
| RNAse-degrading surfactant: RnaseZAP | Sigma-Aldrich | R2020 | stored at RT |
| ultrapure LPS from E.coli O111:B4 | Invivogen | stored at -20 °C | |
| Wild type IKKβ plasmid | Addgene | 11103 | stored at -20 °C |
| Wild type NEMO plasmid | Addgene | 27268 | stored at -20 °C |
References
- Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. How Mouse Macrophages Sense What Is Going On. Frontiers in Immunology. 7 (204), (2016).
- Zhang, X., Edwards, J. P., Mosser, D. M. The expression of exogenous genes in macrophages: obstacles and opportunities. Methods in Molecular Biolology. 531, 123-143 (2009).
- Guo, X., et al. Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages. Immunology and cell biology. 97 (1), 92-96 (2019).
- Kariko, K., Weissman, D. Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development. Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).
- Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages. Biochemical and biophysical research communications. 327 (1), 356-360 (2005).
- Uchida, S., Kataoka, K., Itaka, K. Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity. Pharmaceutics. 7 (3), 137-151 (2015).
- Kariko, K., et al. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Molecular Therapy. 16 (11), 1833-1840 (2008).
- Khantakova, J. N., et al. Transfection of bone marrow derived cells with immunoregulatory proteins. Cytokine. 108, 82-88 (2018).
- Franz, K. M., Kagan, J. C. Innate Immune Receptors as Competitive Determinants of Cell Fate. Molecular Cell. 66 (6), 750-760 (2017).
- Kaestner, L., Scholz, A., Lipp, P. Conceptual and technical aspects of transfection and gene delivery. Bioorganic & medicinal chemistry letters. 25 (6), 1171-1176 (2015).
- Kim, T. K., Eberwine, J. H. Mammalian cell transfection: the present and the future. Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).
- Kormann, M. S., et al. Expression of therapeutic proteins after delivery of chemically modified mRNA in mice. Nature Biotechnology. 29 (2), 154-157 (2011).
- Kariko, K., Buckstein, M., Ni, H., Weissman, D. Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity. 23 (2), 165-175 (2005).
- Hornung, V., et al. 5′-Triphosphate RNA is the ligand for RIG-I. Science. 314 (5801), 994-997 (2006).
- Pichlmair, A., et al. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science. 314 (5801), 997-1001 (2006).
- Herb, M., et al. Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO. Science Signaling. 12 (568), (2019).
- Schmidt-Supprian, M., et al. NEMO/IKK gamma-deficient mice model incontinentia pigmenti. Molecular Cell. 5 (6), 981-992 (2000).
- Mandal, P. K., Rossi, D. J. Reprogramming human fibroblasts to pluripotency using modified mRNA. Nature Protocols. 8 (3), 568-582 (2013).
- Oh, S., Kessler, J. A. Design, Assembly, Production, and Transfection of Synthetic Modified mRNA. Methods. 133, 29-43 (2018).
