Isoleer celtypespecifieke RNA's uit snap-frozen heterogene weefselmonsters zonder celsortering
Summary
Dit protocol is bedoeld om celtypespecifiek te isoleren, ribosomale mRNA’s te vertalen met behulp van het NuTRAP-muismodel.
Abstract
Cellulaire heterogeniteit vormt een uitdaging voor het begrijpen van de functie van complexe weefsels op transcriptoomniveau. Het gebruik van celtypespecifieke RNA’s vermijdt potentiële valkuilen veroorzaakt door de heterogeniteit van weefsels en ontketent de krachtige transcriptoomanalyse. Het hier beschreven protocol demonstreert hoe de Translating Ribosome Affinity Purification (TRAP) methode kan worden gebruikt om ribosoomgebonden RNA’s te isoleren van een kleine hoeveelheid EGFP-expresserende cellen in een complex weefsel zonder celsortering. Dit protocol is geschikt voor het isoleren van celtypespecifieke RNA’s met behulp van het onlangs beschikbare NuTRAP-muismodel en kan ook worden gebruikt om RNA’s te isoleren van EGFP-expressiecellen.
Introduction
High-throughput benaderingen, waaronder RNA-sequencing (RNA-seq) en microarray, hebben het mogelijk gemaakt om genexpressieprofielen op genoombreed niveau te ondervragen. Voor complexe weefsels zoals het hart, de hersenen en testis zullen de celtypespecifieke gegevens meer details geven waarin het gebruik van RNA’s uit het hele weefsel wordt vergeleken 1,2,3. Om de impact van cellulaire heterogeniteit te overwinnen, is de Translating Ribosome Affinity Purification (TRAP) methode ontwikkeld sinds het begin van de jaren 20104. TRAP is in staat om ribosoomgebonden RNA’s te isoleren van specifieke celtypen zonder weefseldissociatie. Deze methode is gebruikt voor translatoom (mRNA’s die worden gerekruteerd voor het ribosoom voor vertaling) analyse in verschillende organismen, waaronder het richten op een uiterst zeldzame populatie spiercellen in Drosophila embryo’s5, het bestuderen van verschillende wortelcellen in de modelplant Arabidopsis thaliana6, en het uitvoeren van transcriptoomanalyse van endotheelcellen bij zoogdieren7.
TRAP vereist een genetische modificatie om het ribosoom van een modelorganisme te labelen. Evan Rosen en collega’s hebben onlangs een muismodel ontwikkeld met de naam Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) muis8, dat sinds 2017 beschikbaar is via het Jackson Laboratory. Door te kruisen met een Cre-muislijn kunnen onderzoekers dit NuTRAP-muismodel gebruiken om ribosoomgebonden RNA’s en celkernen te isoleren van Cre-tot expressie brengende cellen zonder celsortering. In Cre-expresserende cellen die ook het NuTRAP-allel dragen, maakt het EGFP / L10a-gelabelde ribosoom de isolatie mogelijk van het vertalen van mRNA’s met behulp van affiniteit pulldown-assays. In dezelfde cel maakt het biotine ligase herkenningspeptide (BLRP)-gelabelde kernmembraan, dat ook mCherry-positief is, de nucleaire isolatie mogelijk door gebruik te maken van affiniteits- of fluorescentiegebaseerde zuivering. Hetzelfde onderzoeksteam genereerde ook een vergelijkbare muislijn waarin het kernmembraan alleen wordt gelabeld met mCherry zonder biotine8. Deze twee genetisch gemodificeerde muislijnen geven toegang tot het karakteriseren van gepaarde epigenomische en transcriptomische profielen van specifieke soorten cellen in belang.
De egel (Hh) signaleringsroute speelt een cruciale rol in de weefselontwikkeling9. GLI1, een lid van de GLI-familie, fungeert als een transcriptionele activator en bemiddelt de Hh-signalering. Gli1+ cellen zijn te vinden in veel hormoonafscheidende organen, waaronder de bijnier en de testis. Om celtypespecifieke DNA’s en RNA’s uit Gli1+ cellen te isoleren met behulp van het NuTRAP-muismodel , werden Gli1-CreERT2-muizen gekruist met de NuTRAP-muizen . Shh-CreERT2-muizen werden ook gekruist met de NuTRAP-muizen die sonische egel (Shh) tot expressie brengen van cellen te isoleren. Het volgende protocol laat zien hoe u Gli1-CreERT2 gebruikt; NuTRAP-muizen om ribosoomgebonden RNA’s te isoleren uit Gli1+ cellen in volwassen muistestes.
Protocol
Representative Results
Discussion
Het nut van de analyse van het hele weefsel transcriptoom kan worden gedempt, vooral bij het bestuderen van complexe heterogene weefsels. Het verkrijgen van celtype-specifieke RNA’s wordt een dringende noodzaak om de krachtige RNA-seq-techniek te ontketenen. De isolatie van celtypespecifieke RNA’s is meestal afhankelijk van het verzamelen van een specifiek type cellen met behulp van micromanipulatie, fluorescent-activated cell sorting (FACS) of laser capture microdissection (LCM)18. Andere moderne…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd gedeeltelijk ondersteund door NIH R00HD082686. We bedanken de Endocrine Society Summer Research Fellowship aan H.S.Z. We bedanken ook Dr. Yuan Kang voor het fokken en onderhouden van de muizenkolonie.
Materials
| Actb | eurofins | qPCR primers | ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer) |
| Bioanalyzer | Agilent | 2100 Bioanalyzer Instrument | |
| cOmplete Mini EDTA-free Protease Inhibitor Cocktail | Millipore | 11836170001 | |
| cycloheximide | Millipore | 239764-100MG | |
| Cyp11a1 | eurofins | qPCR primers | CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer) |
| dNTP | Thermo Fisher Scientific | R0191 | |
| DTT, Dithiothreitol | Thermo Fisher Scientific | P2325 | |
| DynaMag-2 magnet | Thermo Fisher Scientific | 12321D | |
| Falcon tubes 15 mL | VWR | 89039-666 | |
| GFP antibody | Abcam | ab290 | |
| Glass grinder set | DWK Life Sciences | 357542 | |
| heparin | BEANTOWN CHEMICAL | 139975-250MG | |
| Hsd3b | eurofins | qPCR primers | GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer) |
| KCl | Biosciences | R005 | |
| MgCl2 | Biosciences | R004 | |
| Microcentrifuge tubes 2 mL | Thermo Fisher Scientific | 02-707-354 | |
| Mouse Clariom S Assay microarrays | Thermo Fisher Scientific | Microarray service | |
| NP-40 | Millipore | 492018-50 Ml | |
| oligo (dT)20 | Invitrogen | 18418020 | |
| PicoPure RNA Isolation Kit | Thermo Fisher Scientific | KIT0204 | |
| Protein G Dynabead | Thermo Fisher Scientific | 10003D | |
| RNase-free water | growcells | NUPW-0500 | |
| RNaseOUT Recombinant Ribonuclease Inhibitor | Thermo Fisher Scientific | 10777019 | |
| Sox9 | eurofins | qPCR primers | TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer |
| Superscript IV reverse transcriptase | Invitrogen | 18090050 | |
| SYBR Green PCR Master Mix | Thermo Fisher Scientific | 4309155 | |
| Sycp3 | eurofins | qPCR primers | GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer) |
| Tris | Alfa Aesar | J62848 |
References
- Yang, K. C., et al. Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support. Circulation. 129 (9), 1009-1021 (2014).
- Soumillon, M., et al. Cellular source and mechanisms of high transcriptome complexity in the mammalian testis. Cell Reports. 3 (6), 2179-2190 (2013).
- Lake, B. B., et al. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain. Science. 352 (6293), 1586-1590 (2016).
- Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP). Nature Protocols. 9 (6), 1282-1291 (2014).
- Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos. Journal of Visualized Experiments: JoVE. (103), e52985 (2015).
- Thellmann, M., Andersen, T. G., Vermeer, J. E. Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale. Journal of Visualized Experiments: JoVE. (159), e60919 (2020).
- Moran, P., et al. Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo. Journal of Visualized Experiments: JoVE. (147), e59624 (2019).
- Roh, H. C., et al. Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo. Cell Reports. 18 (4), 1048-1061 (2017).
- Varjosalo, M., Taipale, J. Hedgehog: functions and mechanisms. Genes & Development. 22 (18), 2454-2472 (2008).
- Mueller, O., Lightfoot, S., Schroeder, A. RNA integrity number (RIN)-standardization of RNA quality control. Agilent Technologies. , 1-8 (2004).
- Lyu, Q., et al. RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone. Endocrinology. 161 (9), (2020).
- King, P., Paul, A., Laufer, E. Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages. Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).
- Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog. Endocrinology. 151 (3), 1119-1128 (2010).
- Benton, L., Shan, L. -. X., Hardy, M. P. Differentiation of adult Leydig cells. The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).
- Monder, C., Hardy, M., Blanchard, R., Blanchard, D. Comparative aspects of 11β-hydroxysteroid dehydrogenase. Testicular 11β-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids. Steroids. 59 (2), 69-73 (1994).
- Bitgood, M. J., Shen, L., McMahon, A. P. Sertoli cell signaling by Desert hedgehog regulates the male germline. Current Biology. 6 (3), 298-304 (1996).
- Beverdam, A., et al. Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice. Reproduction. 137 (3), 481 (2009).
- Gross, A., et al. Technologies for single-cell isolation. International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).
- Ziegenhain, C., et al. Comparative analysis of single-cell RNA sequencing methods. Molecular Cell. 65 (4), 631-643 (2017).
- Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. Experimental considerations for single-cell rna sequencing approaches. Frontiers in Cell and Development Biology. 6, 108 (2018).
- Chucair-Elliott, A. J., et al. Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia. Communications Biology. 3 (1), 693 (2020).
- Barsoum, I., Yao, H. H. Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells. Biology of Reproduction. 84 (5), 894-899 (2011).
- Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. Morphometric analysis of testicular Leydig cells in normal adult mice. The Anatomical Record. 204 (4), 333-339 (1982).
