Summary

Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice

Published: March 30, 2022
doi:

Summary

Ultrasound-guided cell delivery around the site of myocardial infarction in mice is a safe, effective, and convenient way of cell transplantation.

Abstract

The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are a promising cell source for cardiac repair after ischemic damage. However, a low grafted rate is a significant obstacle for effective cardiac tissue regeneration after transplantation. This protocol shows that multiple hiPSC-CM ultrasound-guided percutaneous injections into an MI area effectively increase cell transplantation rates. The study also describes the entire hiPSC-CM culture process, pretreatment, and ultrasound-guided percutaneous delivery methods. In addition, the use of human mitochondrial DNA help detect the absence of hiPSC-CMs in other mouse organs. Lastly, this paper describes the changes in cardiac function, angiogenesis, cell size, and apoptosis at the infarcted border zone in mice 4 weeks after cell delivery. It can be concluded that echocardiography-guided percutaneous injection of the left ventricular myocardium is a feasible, relatively invasive, satisfactory, repeatable, and effective cellular therapy.

Introduction

When acute MI occurs, myocardial cells in the infarcted area die quickly due to ischemia and hypoxia. Several inflammatory factors are released after cell death and rupture, while inflammatory cells infiltrate the infarcted site to cause inflammation1. Significantly, fibroblasts and collagen, both without contractility and electrical conductivity, replace the myocardial cells in the infarcted site to form scar tissue. Due to the limited regeneration capacity of cardiomyocytes in adult mammals, viable tissue formed after a large area of infarction is usually not adequate for maintaining sufficient cardiac output2. MI causes heart failure, and in severe cases of heart failure, patients can only rely on heart transplants or ventricular assist devices to maintain normal heart functions3,4.

After MI, the ideal treatment strategy is to replace the dead cardiomyocytes with newly formed cardiomyocytes, forming electromechanical coupling with healthy tissues. However, treatment options have typically adopted myocardial salvage rather than replacement. Currently, stem cell- and progenitor cell-based therapies are among the most promising strategies to promote myocardial repair after MI5. However, the transplantation of these cells has several issues, primarily the inability of adult stem cells to differentiate into cardiomyocytes and their short life span6.

The ethical issues related to the use of embryonic stem (ES) cells can be circumvented by iPSCs, which are a promising source of cells. In addition, iPSCs possess strong self-renewal capabilities and can differentiate into cardiomyocytes7. Studies have shown that hiPSC-CMs transplanted into the MI site can survive and form gap junctions with host cells8,9. However, because these transplanted cells are located in the microenvironment of ischemia and inflammation, their survival rate is extremely low10,11.

Several methods have been established to improve the survival rate of transplanted cells, such as hypoxia and heat shock pretreatment of transplanted cells12,13, genetic modification14,15, and the simultaneous transplantation of cells and capillaries16. Unfortunately, most methods are limited by complexity and high cost. Hence, the present study proposes a reproducible, convenient, relatively invasive, and effective hiPSC-CM delivery method.

Ultrasound-guided intramyocardial cell injection can be carried out with only a high-resolution small veterinary ultrasound machine and a microinjector, regardless of the site. Under ultrasound guidance, directly delivering cells under the xiphoid process from the pericardium into the myocardium in mice is a safe protocol that avoids liver and lung damage. This method can be combined simultaneously with other technologies to significantly improve the survival rate of transplanted cells.

Protocol

All animal experiments in this study were reviewed and approved by the ethics committee of the Second Xiangya Hospital of Central South University. See the Table of Materials for details regarding all the materials and equipment used in this protocol. The timelines for cell injection, imaging and euthansia are as follows: t0- induce infarction, t1 week- image and implant cells, t2 weeks- image and implant cells, t4 weeks- final imaging, euthanasia and tissue collection.  <s…

Representative Results

Echocardiography for evaluation of the left ventricular function of the mice in each group revealed that the MI injuries were effectively reversed in the MD group (Figure 2A). Compared with the MI group, the SD group showed increased ejection fraction (EF) (from 30% to 35%; Figure 2B) and fraction shortening (FS) (from 18% to 22%; Figure 2C) after MI. However, it is even more crucial to note that multiple injections of the hiPSC-CMs…

Discussion

The critical steps of this study include hiPSC culture, cardiomyocyte differentiation, hiPSC-CM purification, and hiPSC-CM transplantation into the mouse myocardial infarction site. The key is to use cardiac ultrasound to transcutaneously guide treatment toward the infarct site at the edge of the infarction where hiPSC-CMs were injected into the area.

With the prolongation of culture time, the hiPSC-CM phenotype changes in morphology (larger cell size), structure (muscle, fibril density, arran…

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by the Major Research Plan of the National Natural Science Foundation of China (No. 91539111to JY), Key Project of Science and Technology of Hunan Province (No. 2020SK53420 to JY) and The Science and Technology Innovation Program of Hunan Province (2021RC2106 to CF).

Materials

Antibody
Cardiac troponin T Abcam ab8295
Donkey Anti-Mouse IgG H&L (Alexa Fluor 488) Abcam ab150105
Donkey Anti-Mouse IgG H&L (Alexa Fluor 555) Abcam ab150110
Donkey Anti-Rabbit IgG H&L (Alexa Fluor 488) Abcam ab150073
Donkey Anti-Rabbit IgG H&L (Alexa Fluor 555) Abcam ab150062
Human cardiac troponin T Abcam ab91605
Isolectin B4 Vector FL-1201
Sarcomeric alpha actinin Abcam ab9465
Wheat germ agglutinin Thermo Fisher Scientific W11261
Reagent
Accutase Thermo Fisher Scientific 00-4555-56
B27 Supplement(minus insulin) Thermo Fisher Scientific A1895601
B27 Supplement(serum free) Thermo Fisher Scientific 17–504-044
Bouin's solution Thermo Fisher Scientific SDHT10132
CHIR99021 Selleck CT99021
cyclosporin A Medchemexpress HY-B0579
DIRECT RED Sigma-Aldrich 365548-25G
DMEM/F12 Thermo Fisher Scientific 11320033
DNeasy Blood & Tissue Kit Qiagen 69504
FAST GREEN FCF Sigma-Aldrich  F7252-5G
Glucose-free RPMI 1640 Thermo Fisher Scientific 11879020
IWR1 Selleck S7086
lactic acid Sigma-Aldrich L6661
Matrigel BD Biosciences BD356234
mTeSR1 Stem Cell Technologies 72562
O.C.T. Compound SAKURA 4583
Paraformaldehyde Sigma-Aldrich 158127
PowerUP SYBR Green MasterMix kit Thermo Fisher Scientific A25742
RPMI1640 Thermo Fisher Scientific 11875119
STEMdif Cardiomyocyte Freezing Medium/STEMdiff Stem Cell Technologies 5030
STEMdiff Cardiomyocyte Support Medium Stem Cell Technologies 5027
Triton X-100 Sigma-Aldrich T8787
ultrasound coupling agent CARENT 22396269389
Y-27632 Selleck S6390
Equipment and Supplies
Applied Biosystems Thermo Fisher Scientific 7500 Real-Time PCR
cryostat Leica CM1950
fluoresence microscope Olympus IX83
fine anatomical scissors Fine Science Tools 15000-08
fine dissecting forceps Fine Science Tools 11255-20
Micro syringe Hamilton 7633
Small animal anesthesia machine MATRX VMR
Ultra-high resolution small animal ultrasound imaging system VisualSonics Vevo 2100
Software
Statistical Product and Service Solutions IBM 21
Image J NIH 1.48
Human mitochondrial DNA primers
the forward primer sequence CCGCTACCATAATCATCGCTAT
the reverse primer sequence TGCTAATACAATGCCAGTCAGG

References

  1. Leuschner, F., et al. Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis. The Journal of Experimental Medicine. 209 (1), 123-137 (2012).
  2. Lázár, E., et al. Cardiomyocyte renewal in the human heart: insights from the fall-out. European Heart Journal. 38 (30), 2333-2342 (2017).
  3. Davis, M. K., et al. State of the art: cardiac transplantation. Trends in Cardiovascular Medicine. 24 (8), 341-349 (2014).
  4. Mancini, D., Colombo, P. C. Left ventricular assist devices: A rapidly evolving alternative to transplant. Journal of the American College of Cardiology. 65 (23), 2542-2555 (2015).
  5. Zimmermann, W. H. Translating myocardial remuscularization. Circulation Research. 120 (2), 278-281 (2017).
  6. Hu, X., et al. A large-scale investigation of hypoxia-preconditioned allogeneic mesenchymal stem cells for myocardial repair in nonhuman primates: Paracrine activity without remuscularization. Circulation Research. 118 (6), 970-983 (2016).
  7. Kempf, H., et al. Cardiac differentiation of human pluripotent stem cells in scalable suspension culture. Nature Protocols. 10 (9), 1345-1361 (2015).
  8. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510 (7504), 273-277 (2014).
  9. Shiba, Y., et al. Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts. Nature. 538 (7625), 388-391 (2016).
  10. Nguyen, P. K., et al. Potential strategies to address the major clinical barriers facing stem cell regenerative therapy for cardiovascular disease: A review. JAMA Cardiology. 1 (8), 953-962 (2016).
  11. Zimmermann, W. H. Remuscularization of the failing heart. The Journal of Physiology. 595 (12), 3685-3690 (2017).
  12. Hu, X., et al. Transplantation of hypoxia-preconditioned mesenchymal stem cells improves infarcted heart function via enhanced survival of implanted cells and angiogenesis. The Journal of Thoracic and Cardiovascular Surgery. 135 (4), 799-808 (2008).
  13. Feng, Y., et al. Heat shock improves Sca-1+ stem cell survival and directs ischemic cardiomyocytes toward a prosurvival phenotype via exosomal transfer: a critical role for HSF1/miR-34a/HSP70 pathway. Stem Cells. 32 (2), 462-472 (2014).
  14. Fan, C., et al. Cardiomyocytes from CCND2-overexpressing human induced-pluripotent stem cells repopulate the myocardial scar in mice: A 6-month study. Journal of Molecular and Cellular Cardiology. 137, 25-33 (2019).
  15. Lou, X., et al. N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts. Cardiovascular Research. 116 (3), 671-685 (2020).
  16. Sun, X., et al. Transplanted microvessels improve pluripotent stem cell-derived cardiomyocyte engraftment and cardiac function after infarction in rats. Science Translational Medicine. 12 (562), (2020).
  17. Wu, X., et al. Cardiac repair with echocardiography-guided multiple percutaneous left ventricular intramyocardial injection of hiPSC-CMs after myocardial infarction. Frontiers in Cardiovascular Medicine. 8, 768873 (2021).
  18. Kannappan, R., et al. Functionally competent DNA damage-free induced pluripotent stem cell-derived cardiomyocytes for myocardial repair. Circulation. 140 (6), 520-522 (2019).
  19. Lou, X., et al. N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts. Cardiovascular Research. 116 (3), 671-685 (2020).
  20. Zhao, M., et al. Y-27632 preconditioning enhances transplantation of human-induced pluripotent stem cell-derived cardiomyocytes in myocardial infarction mice. Cardiovascular Research. 115 (2), 343-356 (2019).
  21. Zhao, M., et al. Enhancing the engraftment of human induced pluripotent stem cell-derived cardiomyocytes via a transient inhibition of rho kinase activity. Journal of Visualized Experiments: JoVE. (149), e59452 (2019).
  22. O’Brien, J., Hayder, H., Peng, C. Automated quantification and analysis of cell counting procedures using ImageJ plugins. Journal of Visualized Experiments: JoVE. (117), e54719 (2016).
  23. Kain, V., Prabhu, S. D., Halade, G. V. Inflammation revisited: inflammation versus resolution of inflammation following myocardial infarction. Basic Research in Cardiology. 109 (6), 444 (2014).
  24. Rainer, P. P., et al. Cardiomyocyte-specific transforming growth factor β suppression blocks neutrophil infiltration, augments multiple cytoprotective cascades, and reduces early mortality after myocardial infarction. Circulation Research. 114 (8), 1246-1257 (2014).
  25. Yu, Y., et al. Human embryonic stem cell-derived cardiomyocyte therapy in mouse permanent ischemia and ischemia-reperfusion models. Stem Cell Research & Therapy. 10 (1), 167 (2019).
  26. Iwanaga, K., et al. Effects of G-CSF on cardiac remodeling after acute myocardial infarction in swine. Biochemical and Biophysical Research Communications. 325 (4), 1353-1359 (2004).
check_url/kr/63647?article_type=t

Play Video

Cite This Article
Wu, X., Qin, K., Wang, D., Xiang, K., Peng, J., Guo, J., Yang, J., Fan, C. Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice. J. Vis. Exp. (181), e63647, doi:10.3791/63647 (2022).

View Video