JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
자동 번역
Please note that all translations are automatically generated. Click here for the English version.
생물학

قياس القوى مباشرة داخل حزم الأنابيب الدقيقة النشطة المعاد تشكيلها

Published: May 10, 2022
doi:
10.3791/63819
, ,
1Department of Biological Sciences and Center for Biotechnology and Interdisciplinary Studies,Rensselaer Polytechnic Institute

Summary

هنا ، نقدم بروتوكولا لإعادة تشكيل حزم الأنابيب الدقيقة في المختبر وتحديد القوى التي تمارس داخلها مباشرة باستخدام الاصطياد البصري المتزامن والمجهر الفلوري للانعكاس الداخلي الكلي. يسمح هذا الفحص بقياس القوى والإزاحات الناتجة عن مجموعات البروتين داخل شبكات الأنابيب الدقيقة النشطة على مستوى النانو.

Abstract

تستخدم شبكات الأنابيب الدقيقة في الخلايا لإنجاز مجموعة واسعة من المهام ، بدءا من العمل كمسارات لنقل الحويصلة إلى العمل كمصفوفات متخصصة أثناء الانقسام الفتيلي لتنظيم فصل الكروموسومات. تشمل البروتينات التي تتفاعل مع الأنابيب الدقيقة محركات مثل الكينيسين والداينين ، والتي يمكن أن تولد قوى نشطة وحركة اتجاهية ، بالإضافة إلى البروتينات غير الحركية التي تربط الخيوط في شبكات أعلى مرتبة أو تنظم ديناميكيات الخيوط. حتى الآن ، ركزت الدراسات الفيزيائية الحيوية للبروتينات المرتبطة بالأنابيب الدقيقة بشكل كبير على دور البروتينات الحركية المفردة اللازمة لنقل الحويصلة ، وتم إحراز تقدم كبير في توضيح خصائص توليد القوة والتنظيم الكيميائي الميكانيكي للكينيسين والداينين. ومع ذلك ، بالنسبة للعمليات التي تعمل فيها الأنابيب الدقيقة كشحنة ومسار ، كما هو الحال أثناء انزلاق الفتيل داخل المغزل الانقسامي ، لا يفهم الكثير عن التنظيم الفيزيائي الحيوي لمجموعات البروتينات المتشابكة المعنية. هنا ، نقوم بتفصيل منهجيتنا للتحقيق المباشر في توليد القوة والاستجابة لها داخل شبكات الحد الأدنى من الأنابيب الدقيقة المتشابكة المعاد تشكيلها من الأنابيب الدقيقة المنقاة والبروتينات الانقسامية. يتم ربط أزواج الأنابيب الدقيقة بواسطة البروتينات ذات الأهمية ، ويتم تثبيت أحد الأنابيب الدقيقة إلى غطاء المجهر ، ويتم التلاعب بالأنبوب الدقيق الثاني بواسطة مصيدة بصرية. يسمح الفحص المجهري الفلوري للانعكاس الداخلي الكلي المتزامن بتصور متعدد القنوات لجميع مكونات شبكة الأنابيب الدقيقة هذه حيث تنزلق الخيوط بعيدا لتوليد القوة. نوضح أيضا كيف يمكن استخدام هذه التقنيات لاستكشاف قوى الدفع التي تمارسها مجموعات kinesin-5 وكيف تنشأ قوى الكبح اللزجة بين أزواج الأنابيب الدقيقة المنزلقة المتشابكة بواسطة MAP PRC1 الانقسامي. توفر هذه المقايسات نظرة ثاقبة لآليات تجميع المغزل ووظيفته ويمكن تكييفها على نطاق أوسع لدراسة ميكانيكا شبكة الأنابيب الدقيقة الكثيفة في سياقات متنوعة ، مثل المحور العصبي والتشعبات للخلايا العصبية والخلايا الظهارية القطبية.

Introduction

تستخدم الخلايا شبكات الأنابيب الدقيقة لأداء مجموعة متنوعة من المهام الميكانيكية ، بدءا من نقل الحويصلة1،2،3 إلى فصل الكروموسومات أثناء الانقسامالفتيلي 4،5،6. العديد من البروتينات التي تتفاعل مع الأنابيب الدقيقة ، مثل البروتينات الحركية الجزيئية kinesin و dynein ، تولد قوى وتنظمها الأحمال الميكانيكية. لفهم كيفية عمل هذه الجزيئات الحرجة بشكل أفضل ، استخدم الباحثون طرقا فيزيائية حيوية أحادية الجزيء ، مثل الاصطياد البصري والفحص المجهري TIRF ، لمراقبة المعلمات الحرجة بشكل مباشر مثل معدلات الخطوات غير المحملة ، والمعالجة ، وعلاقات القوة والسرعة للبروتينات الفردية. كانت الهندسة التجريبية الأكثر استخداما هي ربط البروتينات الحركية مباشرة بخرز محاصرة تحاكي هندستها الكروية وحجمها الحويصلات التي تخضع للنقل بمحرك. العديد من kinesins ، بما في ذلك kinesin-17،8،9 ، kinesin-2 10،11،12 ، kinesin-3 13،14،15،16 kinesin-5 17،18 ، kinesin-8 19،20 ، وكذلك مجمعات dynein و dynein21,22 ، 23،24،25 ، تمت دراستها بهذه الطرق.

ومع ذلك ، في العديد من العمليات الخلوية ، تستخدم البروتينات الحركية وغير الحركية الأنابيب الدقيقة كمسار وشحن26,27. علاوة على ذلك ، في هذه السيناريوهات حيث يتم ربط خيوط الأنابيب الدقيقة في حزم ذات ترتيب أعلى ، تعمل هذه البروتينات كمجموعات بدلا من وحدات مفردة. على سبيل المثال ، داخل الخلايا الجسدية المنقسمة ، تنظم شبكات الخيوط الكثيفة نفسها لبناء جهاز المغزل الانقسامي28،29،30. شبكة الأنابيب الدقيقة المغزل بين الأقطاب ديناميكية للغاية ويتم ترتيبها إلى حد كبير مع نهايات ناقصة تشير إلى أقطاب المغزل ونهايات زائد متداخلة بالقرب من خط الاستواء المغزل. يتم ربط الخيوط داخل المغزل بواسطة البروتينات الحركية مثل kinesin-5 31،32،33 ، kinesin-12 34،35،36 ، و kinesin-1437،38،39 ، أو بواسطة البروتينات غير الحركية مثلPRC1 40،41،42،43 أو NuMA44،45 ، 46. غالبا ما تتحرك أو تتعرض لإجهاد ميكانيكي أثناء عمليات مثل التدفق القطبي أو أثناء تنسيق تمركز الكروموسوم أثناء الطور الاستوائي أو فصل الكروموسوم أثناء الطورالانفصالي 47،48،49،50،51،52. وبالتالي ، فإن سلامة جهاز المغزل على نطاق ميكرون من خلال الانقسام الميتوزي تعتمد على توازن منظم بعناية بين قوى الدفع والسحب الناتجة والمستدامة بواسطة هذه الشبكة من الخيوط المتفاعلة. ومع ذلك ، فإن الأدوات اللازمة لاستكشاف هذا التنظيم الميكانيكي وشرح كيفية عمل مجموعات البروتين بشكل منسق لتنسيق حركات الأنابيب الدقيقة وإنتاج القوى اللازمة لتجميع المغزل بشكل صحيح لم يتم تطويرها إلا مؤخرا ، ونحن بدأنا للتو في فهم القواعد الفيزيائية الحيوية التي تحدد شبكات الأنابيب الدقيقة الديناميكية.

الهدف من هذه المخطوطة هو إظهار الخطوات المطلوبة لإعادة تكوين أزواج الأنابيب الدقيقة المتشابكة في المختبر، وشل حركة هذه الحزم في غرفة الفحص المجهري التي تسمح بتصور مضان متزامن لكل من الأنابيب الدقيقة والبروتينات المتشابكة وقياس القوة النانوية، ومعالجة هذه البيانات بقوة. نحن نفصل الخطوات اللازمة لبلمرة الأنابيب الدقيقة التي تحمل علامة التألق بشكل ثابت ، وإعداد أغطية المجهر للتعلق ، وإعداد حبات البوليسترين لتجارب الاصطياد البصري ، وتجميع شبكات الخيوط المتشابكة التي تحافظ على وظائفها في الجسم الحي مع السماح بالتلاعب الفيزيائي الحيوي المباشر.

Protocol

1. إعداد الأنابيب الدقيقة ملاحظة: عند استخدام بروتينات متشابكة تحمل علامة GFP ، أحمر (على سبيل المثال ، رودامين) وأحمر بعيد (على سبيل المثال ، HiLyte647 البيوتينيل ، يشار إليه باسم البيوتينيل الأحمر البعيد في بقية النص) يعمل وضع العلامات الفلورية العضوية للأنابيب الدقيقة ب…

Representative Results

يعتبر إعداد حزم الأنابيب الدقيقة المناسبة للتحليل الفيزيائي الحيوي ناجحا إذا تم استيفاء العديد من المعايير الرئيسية. أولا ، يجب أن يكشف التصوير بثلاثة ألوان عن اثنين من الأنابيب الدقيقة المحاذاة مع تركيز البروتين المتشابك الذي يزين منطقة التداخل بشكل تفضيلي (الشكل 5B…

Discussion

يتم استخدام شبكات الأنابيب الدقيقة من قبل أنواع لا تعد ولا تحصى من الخلايا لإنجاز مجموعة واسعة من المهام ذات الطبيعة الميكانيكية بشكل أساسي. من أجل وصف كيفية عمل الخلايا في كل من الحالات الصحية والمرضية ، من الأهمية بمكان فهم كيفية تنظيم هذه الشبكات ذات النطاق الميكروني وتنظيمها بواسطة ا?…

Disclosures

The authors have nothing to disclose.

Acknowledgements

يرغب المؤلفون في الاعتراف بالدعم المقدم من R21 AG067436 (إلى JP و SF) ، و T32 AG057464 (إلى ET) ، وصناديق بدء تشغيل معهد رينسيلار للفنون التطبيقية (إلى SF).

Materials

10W Ytterbium Fiber Laser, 1064nm IPG Photonics YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications Chroma TRF89901v2
6x His Tag Antibody, Biotin Conjugate Invitrogen #MA1-21315-BTIN
Acetone, HPLC grade Fisher Scientific 18-608-395
Alpha casein from bovine milk Sigma 1002484390
ATP Fisher Scientific BP413-25
Benzonase Novagen 70746-3
Biotin-PEG-SVA-5000 Laysan Bio, Inc. NC0479433
BL21 (DE3) Rosetta Cells Millipore Sigma 71-400-3
Catalase MP Biomedicals LLC 190311
CFI Apo 100X/1.49NA oil immersion TIRF objective Nikon N/A
Chloramphenicol ACROS Organics 227920250
Coverslip Mini-Rack, for 8 coverslips Fisher Scientific C14784
Delicate Task Wipers Kimberly-Clark 34120
Dextrose Anhydrous Fisher Scientific BP3501
D-Sucrose Fisher Scientific BP220-1
DTT Fisher Scientific BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath LAUDA-Brinkmann 27709
EDTA Fisher Scientific BP118-500
EGTA Millipore Corporation 32462-25GM
FIJI / Image J https://fiji.sc/ N/A
Frosted Microscope Slides Corning 12-553-10 75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase MP Biomedicals LLC 195196 Type VII, without added oxygen
GMPCPP Jena Biosciences JBS-NU-405S Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass Thermo Scientific 3405
HEPES Fisher Scientific BP310-500
Imidazole Fisher Scientific 03196-500
IPTG Fisher Scientific BP1755-10
Laboratory dessicator Bel-Art 999320237 190mm plate size
Kanamycin Sulfate Fischer Scientific BP906-5
KIF5A K439 (aa:1-439)-6His Gilbert Lab, RPI N/A doi.org/10.1074/jbc.RA118.002182
Kimwipe Kimberley Clark Z188956 lint-free tissue
Immersion Oil, Type B Cargille 16484
Lens Tissue ThorLabs MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) Nikon N/A
Lysozyme MP Biomedicals LLC 100834
Magnesium Acetate Tetrahydrate Fisher Scientific BP215-500
Microfuge 18 Beckman Coulter 367160
MPEG-SVA MW-5000 Laysan Bio, Inc. NC0107576
Neutravadin Invitrogen PI31000
Nikon Ti-E inverted microscope Nikon N/A Nikon LuN4 Laser
Ni-NTA Resin Thermo Scientific 88221
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC		 IDT N/A
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG		 IDT N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm Beckman Coulter 343755
Optima-TLX Ultracentrifuge Beckman Coulter 361544
Paclitaxel (Taxol equivalent) Thermo Fisher Scientific P3456
PIPES ACROS Organics 172615000
PMSF Millipore 7110-5GM
Porcine Tubulin, biotin label Cytoskeleton, Inc. T333P
Porcine Tubulin, HiLyte 647 Fluor Cytoskeleton, Inc. TL670M far red labelled
Porcine Tubulin, Rhodamine Cytoskeleton, Inc. TL590M
Porcine Tubulin, Tubulin Protein Cytoskeleton, Inc. T240
Potassium Acetate Fisher Scientific BP364-500
Prime 95B sCMOS camera Photometric N/A
Quadrant Detector Sensor Head ThorLabs PDQ80A
Quikchange Lightning Kit Agilent Technologies 210518
Sodium Bicarbonate Fisher Scientific S233-500
Sodium Phosphate Dibasic Anhydrous Fisher Scientific BP332-500
Square Cover Glasses Corning 12-553-450 18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres Polysciences Inc. 24162-1
Superose-6 Column GE Healthcare 29-0915–96
TCEP Thermo Scientific 77720
TLA-100 Fixed-Angle Rotor Beckman Coulter 343840
Ultrasonic Cleaner (Sonicator) Vevor JPS-08A(DD) 304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution Vector Laboratories SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D S.C. Johnson SJN695237
DOWNLOAD MATERIALS LIST

References

  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. 생물학. 6 (1), 8 (2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227 (2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257 (2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544 (2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. 생물학. 5 (4), 55 (2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724 (2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659 (2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001 (2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131 (2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. . SMART – Servier Medical ART Available from: https://smart.servier.com/ (2022)
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695 (2018).

Tags

Microtubule BundlesCytoskeletal NetworksForce MeasurementOptical TrapTIRF MicroscopySingle-molecule ExperimentsProtein ConcentrationProtein DensityMitosisNeural DevelopmentMuscle ContractionCell MigrationStreptavidinNeutrAvidinCaseinBiotinylated MicrotubulesRhodamine MicrotubulesRigor Kinesin-coated BeadsReaction Buffer
check_url/kr/63819?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Palumbo, J., Tai, E., Forth, S. Directly Measuring Forces Within Reconstituted Active Microtubule Bundles. J. Vis. Exp. (183), e63819, doi:10.3791/63819 (2022).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image