JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
자동 번역
Please note that all translations are automatically generated. Click here for the English version.
생물학

Directly Measuring Forces Within Reconstituted Active Microtubule Bundles

Published: May 10, 2022
doi:
10.3791/63819
, ,
1Department of Biological Sciences and Center for Biotechnology and Interdisciplinary Studies,Rensselaer Polytechnic Institute

Summary

Here, we present a protocol for reconstituting microtubule bundles in vitro and directly quantifying the forces exerted within them using simultaneous optical trapping and total internal reflection fluorescence microscopy. This assay allows for nanoscale-level measurement of the forces and displacements generated by protein ensembles within active microtubule networks.

Abstract

Microtubule networks are employed in cells to accomplish a wide range of tasks, ranging from acting as tracks for vesicle transport to working as specialized arrays during mitosis to regulate chromosome segregation. Proteins that interact with microtubules include motors such as kinesins and dynein, which can generate active forces and directional motion, as well as non-motor proteins that crosslink filaments into higher-order networks or regulate filament dynamics. To date, biophysical studies of microtubule-associated proteins have overwhelmingly focused on the role of single motor proteins needed for vesicle transport, and significant progress has been made in elucidating the force-generating properties and mechanochemical regulation of kinesins and dyneins. However, for processes in which microtubules act both as cargo and track, such as during filament sliding within the mitotic spindle, much less is understood about the biophysical regulation of ensembles of the crosslinking proteins involved. Here, we detail our methodology for directly probing force generation and response within crosslinked microtubule minimal networks reconstituted from purified microtubules and mitotic proteins. Microtubule pairs are crosslinked by proteins of interest, one microtubule is immobilized to a microscope coverslip, and the second microtubule is manipulated by an optical trap. Simultaneous total internal reflection fluorescence microscopy allows for multichannel visualization of all the components of this microtubule network as the filaments slide apart to generate force. We also demonstrate how these techniques can be used to probe pushing forces exerted by kinesin-5 ensembles and how viscous braking forces arise between sliding microtubule pairs crosslinked by the mitotic MAP PRC1. These assays provide insights into the mechanisms of spindle assembly and function and can be more broadly adapted to study dense microtubule network mechanics in diverse contexts, such as the axon and dendrites of neurons and polar epithelial cells.

Introduction

Cells employ microtubule networks to perform a wide variety of mechanical tasks, ranging from vesicle transport1,2,3 to chromosome segregation during mitosis4,5,6. Many of the proteins that interact with microtubules, such as the molecular motor proteins kinesin and dynein, generate forces and are regulated by mechanical loads. To better understand how these critical molecules function, researchers have employed single-molecule biophysical methods, such as optical trapping and TIRF microscopy, to directly monitor critical parameters such as unloaded stepping rates, processivity, and force-velocity relationships for individual proteins. The most commonly used experimental geometry has been to attach motor proteins directly to trapping beads whose spherical geometry and size mimic vesicles undergoing motor-driven transport. Numerous kinesins, including kinesin-17,8,9, kinesin-210,11,12, kinesin-313,14,15,16 kinesin-517,18, kinesin-819,20, as well as dynein and dynein complexes21,22,23,24,25, have been studied with these methods.

In many cellular processes, however, motor and non-motor proteins use microtubules both as track and cargo26,27. Moreover, in these scenarios where microtubule filaments are crosslinked into higher-order bundles, these proteins function as ensembles rather than single units. For example, within dividing somatic cells, dense filament networks self-organize to build the mitotic spindle apparatus28,29,30. The interpolar spindle microtubule network is highly dynamic and is largely arranged with minus-ends pointing toward the spindle poles and plus-ends overlapping near the spindle equator. Filaments within the spindle are crosslinked by motor proteins such as kinesin-531,32,33, kinesin-1234,35,36, and kinesin-1437,38,39, or by non-motor proteins such as PRC140,41,42,43 or NuMA44,45,46. They frequently move or experience mechanical stress during processes such as poleward flux or while coordinating chromosome centering during metaphase or chromosome segregation during anaphase47,48,49,50,51,52. The integrity of the micron-scale spindle apparatus through mitosis, therefore, relies on a carefully regulated balance of pushing and pulling forces generated and sustained by this network of interacting filaments. However, the tools needed to probe this mechanical regulation and explain how protein ensembles work in concert to coordinate microtubule motions and produce the forces needed to properly assemble the spindle have only recently been developed, and we are just beginning to understand the biophysical rules that define dynamic microtubule networks.

The goal of this manuscript is to demonstrate the steps required to reconstitute crosslinked microtubule pairs in vitro, immobilize these bundles in a microscopy chamber that allows for simultaneous fluorescence visualization of both the microtubules and crosslinking proteins and nanoscale force measurement, and process these data robustly. We detail the steps needed to stably polymerize fluorescence-labeled microtubules, prepare microscope coverslips for attachment, prepare polystyrene beads for optical trapping experiments, and assemble crosslinked filament networks that preserve their in vivo functionality while allowing for direct biophysical manipulation.

Protocol

1. Preparation of microtubules NOTE: When employing GFP-labeled crosslinking proteins, red (e.g., rhodamine) and far-red (e.g., biotinylated HiLyte647, referred to as biotinylated far red in the rest of the text) organic fluorophore labeling of the microtubules works well. Minimal crosstalk between all three channels can be achieved during imaging by using a high-quality quad band total internal reflection fluorescence (TIRF) filter. Prepare GMPCPP microtubule seed…

Representative Results

The preparation of microtubule bundles suitable for biophysical analysis is considered successful if several of the key criteria are met. First, imaging in three colors should reveal two aligned microtubules with a concentration of crosslinking protein preferentially decorating the overlap region (Figure 5B,C and Figure 6B). Ideally, the distance between the overlap edge and the free end of the rhodamine microtubule should be at…

Discussion

Microtubule networks are employed by myriad cell types to accomplish a wide range of tasks that are fundamentally mechanical in nature. In order to describe how cells function in both healthy and disease states, it is critical to understand how these micron-scale networks are organized and regulated by the nanometer-sized proteins that collectively build them. Biophysical tools such as optical tweezers are well suited to probing the mechanochemistry of key proteins at this scale. Reflecting the diversity of microtubule n…

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors wish to acknowledge support from R21 AG067436 (to JP and SF), T32 AG057464 (to ET), and Rensselaer Polytechnic Institute School of Science Startup Funds (to SF).

Materials

10W Ytterbium Fiber Laser, 1064nm IPG Photonics YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications Chroma TRF89901v2
6x His Tag Antibody, Biotin Conjugate Invitrogen #MA1-21315-BTIN
Acetone, HPLC grade Fisher Scientific 18-608-395
Alpha casein from bovine milk Sigma 1002484390
ATP Fisher Scientific BP413-25
Benzonase Novagen 70746-3
Biotin-PEG-SVA-5000 Laysan Bio, Inc. NC0479433
BL21 (DE3) Rosetta Cells Millipore Sigma 71-400-3
Catalase MP Biomedicals LLC 190311
CFI Apo 100X/1.49NA oil immersion TIRF objective Nikon N/A
Chloramphenicol ACROS Organics 227920250
Coverslip Mini-Rack, for 8 coverslips Fisher Scientific C14784
Delicate Task Wipers Kimberly-Clark 34120
Dextrose Anhydrous Fisher Scientific BP3501
D-Sucrose Fisher Scientific BP220-1
DTT Fisher Scientific BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath LAUDA-Brinkmann 27709
EDTA Fisher Scientific BP118-500
EGTA Millipore Corporation 32462-25GM
FIJI / Image J https://fiji.sc/ N/A
Frosted Microscope Slides Corning 12-553-10 75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase MP Biomedicals LLC 195196 Type VII, without added oxygen
GMPCPP Jena Biosciences JBS-NU-405S Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass Thermo Scientific 3405
HEPES Fisher Scientific BP310-500
Imidazole Fisher Scientific 03196-500
IPTG Fisher Scientific BP1755-10
Laboratory dessicator Bel-Art 999320237 190mm plate size
Kanamycin Sulfate Fischer Scientific BP906-5
KIF5A K439 (aa:1-439)-6His Gilbert Lab, RPI N/A doi.org/10.1074/jbc.RA118.002182
Kimwipe Kimberley Clark Z188956 lint-free tissue
Immersion Oil, Type B Cargille 16484
Lens Tissue ThorLabs MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) Nikon N/A
Lysozyme MP Biomedicals LLC 100834
Magnesium Acetate Tetrahydrate Fisher Scientific BP215-500
Microfuge 18 Beckman Coulter 367160
MPEG-SVA MW-5000 Laysan Bio, Inc. NC0107576
Neutravadin Invitrogen PI31000
Nikon Ti-E inverted microscope Nikon N/A Nikon LuN4 Laser
Ni-NTA Resin Thermo Scientific 88221
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC		 IDT N/A
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG		 IDT N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm Beckman Coulter 343755
Optima-TLX Ultracentrifuge Beckman Coulter 361544
Paclitaxel (Taxol equivalent) Thermo Fisher Scientific P3456
PIPES ACROS Organics 172615000
PMSF Millipore 7110-5GM
Porcine Tubulin, biotin label Cytoskeleton, Inc. T333P
Porcine Tubulin, HiLyte 647 Fluor Cytoskeleton, Inc. TL670M far red labelled
Porcine Tubulin, Rhodamine Cytoskeleton, Inc. TL590M
Porcine Tubulin, Tubulin Protein Cytoskeleton, Inc. T240
Potassium Acetate Fisher Scientific BP364-500
Prime 95B sCMOS camera Photometric N/A
Quadrant Detector Sensor Head ThorLabs PDQ80A
Quikchange Lightning Kit Agilent Technologies 210518
Sodium Bicarbonate Fisher Scientific S233-500
Sodium Phosphate Dibasic Anhydrous Fisher Scientific BP332-500
Square Cover Glasses Corning 12-553-450 18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres Polysciences Inc. 24162-1
Superose-6 Column GE Healthcare 29-0915–96
TCEP Thermo Scientific 77720
TLA-100 Fixed-Angle Rotor Beckman Coulter 343840
Ultrasonic Cleaner (Sonicator) Vevor JPS-08A(DD) 304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution Vector Laboratories SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D S.C. Johnson SJN695237
DOWNLOAD MATERIALS LIST

References

  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. 생물학. 6 (1), 8 (2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227 (2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257 (2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544 (2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. 생물학. 5 (4), 55 (2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724 (2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659 (2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001 (2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131 (2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. . SMART – Servier Medical ART Available from: https://smart.servier.com/ (2022)
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695 (2018).

Tags

Microtubule BundlesCytoskeletal NetworksForce MeasurementOptical TrapTIRF MicroscopySingle-molecule ExperimentsProtein ConcentrationProtein DensityMitosisNeural DevelopmentMuscle ContractionCell MigrationStreptavidinNeutrAvidinCaseinBiotinylated MicrotubulesRhodamine MicrotubulesRigor Kinesin-coated BeadsReaction Buffer
check_url/kr/63819?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Palumbo, J., Tai, E., Forth, S. Directly Measuring Forces Within Reconstituted Active Microtubule Bundles. J. Vis. Exp. (183), e63819, doi:10.3791/63819 (2022).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image