Her præsenterer vi en protokol til rekonstituering af mikrotubulusbundter in vitro og direkte kvantificering af de kræfter, der udøves i dem ved hjælp af samtidig optisk fangst og total intern refleksionsfluorescensmikroskopi. Dette assay muliggør måling på nanoskala-niveau af de kræfter og forskydninger, der genereres af proteinensembler inden for aktive mikrotubulinetværk.
Mikrotubulusnetværk anvendes i celler til at udføre en bred vifte af opgaver, lige fra at fungere som spor til vesikeltransport til at arbejde som specialiserede arrays under mitose for at regulere kromosomadskillelse. Proteiner, der interagerer med mikrotubuli, omfatter motorer som kinesiner og dynein, som kan generere aktive kræfter og retningsbestemt bevægelse samt ikke-motoriske proteiner, der tværbinder filamenter i højere ordens netværk eller regulerer filamentdynamik. Hidtil har biofysiske undersøgelser af mikrotubuli-associerede proteiner overvældende fokuseret på rollen som enkeltmotorproteiner, der er nødvendige for vesikeltransport, og der er gjort betydelige fremskridt med at belyse de kraftgenererende egenskaber og mekanokemisk regulering af kinesiner og dyneiner. For processer, hvor mikrotubuli fungerer både som last og spor, såsom under filamentglidning i den mitotiske spindel, forstås der imidlertid meget mindre om den biofysiske regulering af ensembler af de involverede tværbindingsproteiner. Her beskriver vi vores metode til direkte sondering af kraftgenerering og respons inden for tværbundne mikrotubulus minimale netværk rekonstitueret fra oprensede mikrotubuli og mitotiske proteiner. Mikrotubulipar er tværbundet af proteiner af interesse, en mikrotubuli er immobiliseret til et mikroskop dækslip, og den anden mikrotubuli manipuleres af en optisk fælde. Samtidig total intern refleksionsfluorescensmikroskopi muliggør multikanalvisualisering af alle komponenterne i dette mikrotubulinetværk, når filamenterne glider fra hinanden for at generere kraft. Vi demonstrerer også, hvordan disse teknikker kan bruges til at undersøge skubbekræfter, der udøves af kinesin-5-ensembler, og hvordan viskøse bremsekræfter opstår mellem glidende mikrotubuluspar tværbundet af den mitotiske MAP PRC1. Disse assays giver indsigt i mekanismerne for spindelsamling og funktion og kan tilpasses mere bredt til at studere tæt mikrotubulusnetværksmekanik i forskellige sammenhænge, såsom axon- og dendritter af neuroner og polære epitelceller.
Celler anvender mikrotubulusnetværk til at udføre en lang række mekaniske opgaver, lige fra vesikeltransport 1,2,3 til kromosomadskillelse under mitose 4,5,6. Mange af de proteiner, der interagerer med mikrotubuli, såsom de molekylære motorproteiner kinesin og dynein, genererer kræfter og reguleres af mekaniske belastninger. For bedre at forstå, hvordan disse kritiske molekyler fungerer, har forskere anvendt enkeltmolekyle biofysiske metoder, såsom optisk fangst og TIRF-mikroskopi, til direkte at overvåge kritiske parametre såsom ubelastede trinhastigheder, processivitet og krafthastighedsforhold for individuelle proteiner. Den mest almindeligt anvendte eksperimentelle geometri har været at fastgøre motorproteiner direkte til fangstperler, hvis sfæriske geometri og størrelse efterligner vesikler, der gennemgår motordrevet transport. Talrige kinesiner, herunder kinesin-1 7,8,9, kinesin-2 10,11,12, kinesin-3 13,14,15,16 kinesin-517,18, kinesin-8 19,20 samt dynein- og dyneinkomplekser21,22, 23,24,25, er blevet undersøgt med disse metoder.
I mange cellulære processer bruger motoriske og ikke-motoriske proteiner imidlertid mikrotubuli både som spor og last26,27. Desuden fungerer disse proteiner i disse scenarier, hvor mikrotubulifilamenter er tværbundet i højere ordens bundter, som ensembler snarere end enkeltenheder. For eksempel inden for delende somatiske celler organiserer tætte filamentnetværk sig selv for at opbygge det mitotiske spindelapparat28,29,30. Det interpolære spindelmikrotubulinetværk er meget dynamisk og er stort set arrangeret med minusender, der peger mod spindelpolerne og plus-ender overlapper nær spindelækvator. Filamenter i spindlen er tværbundet af motorproteiner såsom kinesin-5 31,32,33, kinesin-12 34,35,36 og kinesin-1437,38,39 eller af ikke-motoriske proteiner såsom PRC1 40,41,42,43 eller NuMA 44,45, 46. De bevæger sig ofte eller oplever mekanisk belastning under processer som polflux eller mens de koordinerer kromosomcentrering under metafase eller kromosomadskillelse under anafase 47,48,49,50,51,52. Integriteten af spindelapparatet i mikronskala gennem mitose er derfor afhængig af en omhyggeligt reguleret balance mellem skubbe- og trækkræfter, der genereres og opretholdes af dette netværk af interagerende filamenter. Imidlertid er de nødvendige værktøjer til at undersøge denne mekaniske regulering og forklare, hvordan proteinensembler arbejder sammen for at koordinere mikrotubulusbevægelser og producere de kræfter, der er nødvendige for korrekt at samle spindlen, først for nylig blevet udviklet, og vi er lige begyndt at forstå de biofysiske regler, der definerer dynamiske mikrotubulusnetværk.
Målet med dette manuskript er at demonstrere de trin, der kræves for at rekonstituere tværbundne mikrotubulipar in vitro, immobilisere disse bundter i et mikroskopikammer, der muliggør samtidig fluorescensvisualisering af både mikrotubuli og tværbindingsproteiner og nanoskala kraftmåling og behandle disse data robust. Vi beskriver de trin, der er nødvendige for stabilt at polymerisere fluorescensmærkede mikrotubuli, forberede mikroskopdæksler til fastgørelse, forberede polystyrenperler til optiske fangsteksperimenter og samle tværbundne filamentnetværk, der bevarer deres in vivo-funktionalitet , samtidig med at de giver mulighed for direkte biofysisk manipulation.
Mikrotubulusnetværk anvendes af utallige celletyper til at udføre en bred vifte af opgaver, der grundlæggende er mekaniske. For at beskrive, hvordan celler fungerer i både sunde og sygdomstilstande, er det afgørende at forstå, hvordan disse mikronskalanetværk er organiseret og reguleret af de nanometerstore proteiner, der kollektivt bygger dem. Biofysiske værktøjer såsom optisk pincet er velegnede til at undersøge mekanokemien af nøgleproteiner i denne skala. Afspejler mangfoldigheden af mikrotubulusnetværks…
The authors have nothing to disclose.
Forfatterne ønsker at anerkende støtte fra R21 AG067436 (til JP og SF), T32 AG057464 (til ET) og Rensselaer Polytechnic Institute School of Science Startup Funds (til SF).
10W Ytterbium Fiber Laser, 1064nm | IPG Photonics | YLR-10-1064-LP | |
405/488/561/640nm Laser Quad Band Set for TIRF applications | Chroma | TRF89901v2 | |
6x His Tag Antibody, Biotin Conjugate | Invitrogen | #MA1-21315-BTIN | |
Acetone, HPLC grade | Fisher Scientific | 18-608-395 | |
Alpha casein from bovine milk | Sigma | 1002484390 | |
ATP | Fisher Scientific | BP413-25 | |
Benzonase | Novagen | 70746-3 | |
Biotin-PEG-SVA-5000 | Laysan Bio, Inc. | NC0479433 | |
BL21 (DE3) Rosetta Cells | Millipore Sigma | 71-400-3 | |
Catalase | MP Biomedicals LLC | 190311 | |
CFI Apo 100X/1.49NA oil immersion TIRF objective | Nikon | N/A | |
Chloramphenicol | ACROS Organics | 227920250 | |
Coverslip Mini-Rack, for 8 coverslips | Fisher Scientific | C14784 | |
Delicate Task Wipers | Kimberly-Clark | 34120 | |
Dextrose Anhydrous | Fisher Scientific | BP3501 | |
D-Sucrose | Fisher Scientific | BP220-1 | |
DTT | Fisher Scientific | BP172-25 | |
Ecoline Immersion Thermostat E100 with 003 Bath | LAUDA-Brinkmann | 27709 | |
EDTA | Fisher Scientific | BP118-500 | |
EGTA | Millipore Corporation | 32462-25GM | |
FIJI / Image J | https://fiji.sc/ | N/A | |
Frosted Microscope Slides | Corning | 12-553-10 | 75mmx25mm, with thickness of 0.9-1.1mm |
Glucose Oxidase | MP Biomedicals LLC | 195196 | Type VII, without added oxygen |
GMPCPP | Jena Biosciences | JBS-NU-405S | Can be stored for several months at -20 °C and up to a year at -80 °C |
Gold Seal-Cover Glass | Thermo Scientific | 3405 | |
HEPES | Fisher Scientific | BP310-500 | |
Imidazole | Fisher Scientific | 03196-500 | |
IPTG | Fisher Scientific | BP1755-10 | |
Laboratory dessicator | Bel-Art | 999320237 | 190mm plate size |
Kanamycin Sulfate | Fischer Scientific | BP906-5 | |
KIF5A K439 (aa:1-439)-6His | Gilbert Lab, RPI | N/A | doi.org/10.1074/jbc.RA118.002182 |
Kimwipe | Kimberley Clark | Z188956 | lint-free tissue |
Immersion Oil, Type B | Cargille | 16484 | |
Lens Tissue | ThorLabs | MC-5 | |
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) | Nikon | N/A | |
Lysozyme | MP Biomedicals LLC | 100834 | |
Magnesium Acetate Tetrahydrate | Fisher Scientific | BP215-500 | |
Microfuge 18 | Beckman Coulter | 367160 | |
MPEG-SVA MW-5000 | Laysan Bio, Inc. | NC0107576 | |
Neutravadin | Invitrogen | PI31000 | |
Nikon Ti-E inverted microscope | Nikon | N/A | Nikon LuN4 Laser |
Ni-NTA Resin | Thermo Scientific | 88221 | |
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA GAACTTTCAAAGGC |
IDT | N/A | |
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA ACTCAGAATAGGTG |
IDT | N/A | |
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm | Beckman Coulter | 343755 | |
Optima-TLX Ultracentrifuge | Beckman Coulter | 361544 | |
Paclitaxel (Taxol equivalent) | Thermo Fisher Scientific | P3456 | |
PIPES | ACROS Organics | 172615000 | |
PMSF | Millipore | 7110-5GM | |
Porcine Tubulin, biotin label | Cytoskeleton, Inc. | T333P | |
Porcine Tubulin, HiLyte 647 Fluor | Cytoskeleton, Inc. | TL670M | far red labelled |
Porcine Tubulin, Rhodamine | Cytoskeleton, Inc. | TL590M | |
Porcine Tubulin, Tubulin Protein | Cytoskeleton, Inc. | T240 | |
Potassium Acetate | Fisher Scientific | BP364-500 | |
Prime 95B sCMOS camera | Photometric | N/A | |
Quadrant Detector Sensor Head | ThorLabs | PDQ80A | |
Quikchange Lightning Kit | Agilent Technologies | 210518 | |
Sodium Bicarbonate | Fisher Scientific | S233-500 | |
Sodium Phosphate Dibasic Anhydrous | Fisher Scientific | BP332-500 | |
Square Cover Glasses | Corning | 12-553-450 | 18 mm x 18 mm, with thickness of 0.13-0.17 mm |
Streptavidin Microspheres | Polysciences Inc. | 24162-1 | |
Superose-6 Column | GE Healthcare | 29-0915–96 | |
TCEP | Thermo Scientific | 77720 | |
TLA-100 Fixed-Angle Rotor | Beckman Coulter | 343840 | |
Ultrasonic Cleaner (Sonicator) | Vevor | JPS-08A(DD) | 304 stainless steel, 40 kHz frequency, 60 W power |
Vectabond APTES solution | Vector Laboratories | SP-1800-7 | |
Windex Powerized Glass Cleaner with Ammonia-D | S.C. Johnson | SJN695237 |