JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
자동 번역
Please note that all translations are automatically generated. Click here for the English version.
생물학

Direct meten van krachten binnen gereconstitueerde actieve microtubulibundels

Published: May 10, 2022
doi:
10.3791/63819
, ,
1Department of Biological Sciences and Center for Biotechnology and Interdisciplinary Studies,Rensselaer Polytechnic Institute

Summary

Hier presenteren we een protocol voor het reconstitueren van microtubulibundels in vitro en het direct kwantificeren van de krachten die erin worden uitgeoefend met behulp van gelijktijdige optische vangmethoden en totale interne reflectiefluorescentiemicroscopie. Deze test maakt het mogelijk om op nanoschaal de krachten en verplaatsingen te meten die worden gegenereerd door eiwitensembles binnen actieve microtubulinetwerken.

Abstract

Microtubule-netwerken worden in cellen gebruikt om een breed scala aan taken uit te voeren, variërend van het fungeren als sporen voor blaasjestransport tot het werken als gespecialiseerde arrays tijdens mitose om chromosoomsegregatie te reguleren. Eiwitten die interageren met microtubuli omvatten motoren zoals kinesines en dyneïne, die actieve krachten en directionele beweging kunnen genereren, evenals niet-motorische eiwitten die filamenten kruisen in netwerken van hogere orde of de filamentdynamica reguleren. Tot op heden hebben biofysische studies van microtubule-geassocieerde eiwitten zich overweldigend gericht op de rol van enkelvoudige motoreiwitten die nodig zijn voor vesikeltransport, en er is aanzienlijke vooruitgang geboekt bij het ophelderen van de krachtgenererende eigenschappen en mechanochemische regulatie van kinesines en dyneinen. Voor processen waarbij microtubuli zowel als lading als spoor fungeren, zoals tijdens het glijden van filamenten in de mitotische spil, wordt echter veel minder begrepen over de biofysische regulatie van ensembles van de betrokken crosslinking-eiwitten. Hier beschrijven we onze methodologie voor het direct onderzoeken van krachtgeneratie en respons binnen crosslinked microtubule minimale netwerken gereconstitueerd uit gezuiverde microtubuli en mitotische eiwitten. Microtubule-paren worden gekruist door eiwitten van belang, één microtubuli wordt geïmmobiliseerd tot een microscoopdeksel en de tweede microtubuli worden gemanipuleerd door een optische val. Gelijktijdige totale interne reflectie fluorescentiemicroscopie maakt meerkanaals visualisatie van alle componenten van dit microtubulinetwerk mogelijk terwijl de filamenten uit elkaar glijden om kracht te genereren. We laten ook zien hoe deze technieken kunnen worden gebruikt om duwkrachten van kinesine-5 ensembles te onderzoeken en hoe viskeuze remkrachten ontstaan tussen glijdende microtubuliparen die door de mitotische MAP PRC1 worden gekruist. Deze testen bieden inzicht in de mechanismen van spindelassemblage en -functie en kunnen breder worden aangepast om dichte microtubule-netwerkmechanica in verschillende contexten te bestuderen, zoals het axon en dendrieten van neuronen en polaire epitheelcellen.

Introduction

Cellen maken gebruik van microtubule-netwerken om een breed scala aan mechanische taken uit te voeren, variërend van blaasjestransport 1,2,3 tot chromosoomsegregatie tijdens mitose 4,5,6. Veel van de eiwitten die interageren met microtubuli, zoals de moleculaire motoreiwitten kinesine en dyneïne, genereren krachten en worden gereguleerd door mechanische belastingen. Om beter te begrijpen hoe deze kritieke moleculen functioneren, hebben onderzoekers biofysische methoden met één molecuul gebruikt, zoals optische vangst en TIRF-microscopie, om kritieke parameters zoals onbelaste stapsnelheden, processiviteit en krachtsnelheidsrelaties voor individuele eiwitten direct te controleren. De meest gebruikte experimentele geometrie is geweest om motoreiwitten rechtstreeks aan vangkralen te bevestigen waarvan de bolvormige geometrie en grootte blaasjes nabootsen die motorisch transport ondergaan. Talrijke kinesines, waaronder kinesine-1 7,8,9, kinesine-2 10,11,12, kinesine-3 13,14,15,16 kinesine-5 17,18, kinesine-819,20, evenals dyneïne- en dyneïnecomplexen21,22, 23,24,25, zijn bestudeerd met deze methoden.

In veel cellulaire processen gebruiken motorische en niet-motorische eiwitten echter microtubuli zowel als spoor en lading 26,27. Bovendien, in deze scenario’s waarin microtubule filamenten worden gekruist in bundels van hogere orde, functioneren deze eiwitten als ensembles in plaats van enkele eenheden. Binnen delende somatische cellen organiseren dichte filamentnetwerken zich bijvoorbeeld zelf om het mitotische spindelapparaat 28,29,30 te bouwen. Het interpolaire spindelmicrotubulinetwerk is zeer dynamisch en is grotendeels gerangschikt met min-uiteinden die naar de spindelpolen wijzen en pluseinden die overlappen in de buurt van de spindelequator. Filamenten in de spil worden verknoopt door motoreiwitten zoals kinesine-5 31,32,33, kinesine-12 34,35,36 en kinesine-14 37,38,39, of door niet-motorische eiwitten zoals PRC1 40,41,42,43 of NuMA44,45, 46. Ze bewegen vaak of ervaren mechanische stress tijdens processen zoals poolwaartse flux of tijdens het coördineren van chromosoomcentrering tijdens metafase of chromosoomsegregatie tijdens anafase 47,48,49,50,51,52. De integriteit van het spindelapparaat op micronschaal door mitose is daarom afhankelijk van een zorgvuldig gereguleerde balans van duw- en trekkrachten die worden gegenereerd en ondersteund door dit netwerk van interagerende filamenten. De hulpmiddelen die nodig zijn om deze mechanische regulatie te onderzoeken en uit te leggen hoe eiwitensembles samenwerken om microtubulibewegingen te coördineren en de krachten te produceren die nodig zijn om de spindel goed te assembleren, zijn echter pas onlangs ontwikkeld en we beginnen nog maar net de biofysische regels te begrijpen die dynamische microtubule-netwerken definiëren.

Het doel van dit manuscript is om de stappen te demonstreren die nodig zijn om crosslinked microtubule-paren in vitro te reconstrueren, deze bundels te immobiliseren in een microscopiekamer die gelijktijdige fluorescentievisualisatie van zowel de microtubuli als crosslinking-eiwitten en nanoschaalkrachtmeting mogelijk maakt, en deze gegevens robuust te verwerken. We beschrijven de stappen die nodig zijn om fluorescentie-gelabelde microtubuli stabiel te polymeriseren, microscoop coverslips voor bevestiging voor te bereiden, polystyreenparels voor optische vangexperimenten voor te bereiden en verknoopte filamentnetwerken samen te stellen die hun in vivo functionaliteit behouden terwijl directe biofysische manipulatie mogelijk is.

Protocol

1. Bereiding van microtubuli OPMERKING: Bij het gebruik van GFP-gelabelde crosslinking-eiwitten, rood (bijv. Rhodamine) en verrood (bijv. Gebiotinyleerd HiLyte647, in de rest van de tekst veel rood gebiotinyleerd) werkt organische fluorofooretikettering van de microtubuli goed. Minimale overspraak tussen alle drie de kanalen kan worden bereikt tijdens de beeldvorming door gebruik te maken van een hoogwaardig quad-band total internal reflection fluorescence (TIRF) filter. <ol…

Representative Results

De bereiding van microtubulibundels die geschikt zijn voor biofysische analyse wordt als succesvol beschouwd als aan een aantal van de belangrijkste criteria wordt voldaan. Ten eerste moet beeldvorming in drie kleuren twee uitgelijnde microtubuli onthullen met een concentratie van crosslinking-eiwit dat bij voorkeur het overlapgebied versiert (figuur 5B, C en figuur 6B). Idealiter moet de afstand tussen de overlaprand en het vri…

Discussion

Microtubule-netwerken worden gebruikt door talloze celtypen om een breed scala aan taken uit te voeren die fundamenteel mechanisch van aard zijn. Om te beschrijven hoe cellen functioneren in zowel gezonde als ziektetoestanden, is het van cruciaal belang om te begrijpen hoe deze netwerken op micronschaal worden georganiseerd en gereguleerd door de eiwitten ter grootte van een nanometer die ze gezamenlijk bouwen. Biofysische hulpmiddelen zoals een optisch pincet zijn zeer geschikt om de mechanochemie van belangrijke eiwitt…

Disclosures

The authors have nothing to disclose.

Acknowledgements

De auteurs willen steun erkennen van R21 AG067436 (naar JP en SF), T32 AG057464 (naar ET) en Rensselaer Polytechnic Institute School of Science Startup Funds (naar SF).

Materials

10W Ytterbium Fiber Laser, 1064nm IPG Photonics YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications Chroma TRF89901v2
6x His Tag Antibody, Biotin Conjugate Invitrogen #MA1-21315-BTIN
Acetone, HPLC grade Fisher Scientific 18-608-395
Alpha casein from bovine milk Sigma 1002484390
ATP Fisher Scientific BP413-25
Benzonase Novagen 70746-3
Biotin-PEG-SVA-5000 Laysan Bio, Inc. NC0479433
BL21 (DE3) Rosetta Cells Millipore Sigma 71-400-3
Catalase MP Biomedicals LLC 190311
CFI Apo 100X/1.49NA oil immersion TIRF objective Nikon N/A
Chloramphenicol ACROS Organics 227920250
Coverslip Mini-Rack, for 8 coverslips Fisher Scientific C14784
Delicate Task Wipers Kimberly-Clark 34120
Dextrose Anhydrous Fisher Scientific BP3501
D-Sucrose Fisher Scientific BP220-1
DTT Fisher Scientific BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath LAUDA-Brinkmann 27709
EDTA Fisher Scientific BP118-500
EGTA Millipore Corporation 32462-25GM
FIJI / Image J https://fiji.sc/ N/A
Frosted Microscope Slides Corning 12-553-10 75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase MP Biomedicals LLC 195196 Type VII, without added oxygen
GMPCPP Jena Biosciences JBS-NU-405S Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass Thermo Scientific 3405
HEPES Fisher Scientific BP310-500
Imidazole Fisher Scientific 03196-500
IPTG Fisher Scientific BP1755-10
Laboratory dessicator Bel-Art 999320237 190mm plate size
Kanamycin Sulfate Fischer Scientific BP906-5
KIF5A K439 (aa:1-439)-6His Gilbert Lab, RPI N/A doi.org/10.1074/jbc.RA118.002182
Kimwipe Kimberley Clark Z188956 lint-free tissue
Immersion Oil, Type B Cargille 16484
Lens Tissue ThorLabs MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) Nikon N/A
Lysozyme MP Biomedicals LLC 100834
Magnesium Acetate Tetrahydrate Fisher Scientific BP215-500
Microfuge 18 Beckman Coulter 367160
MPEG-SVA MW-5000 Laysan Bio, Inc. NC0107576
Neutravadin Invitrogen PI31000
Nikon Ti-E inverted microscope Nikon N/A Nikon LuN4 Laser
Ni-NTA Resin Thermo Scientific 88221
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC		 IDT N/A
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG		 IDT N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm Beckman Coulter 343755
Optima-TLX Ultracentrifuge Beckman Coulter 361544
Paclitaxel (Taxol equivalent) Thermo Fisher Scientific P3456
PIPES ACROS Organics 172615000
PMSF Millipore 7110-5GM
Porcine Tubulin, biotin label Cytoskeleton, Inc. T333P
Porcine Tubulin, HiLyte 647 Fluor Cytoskeleton, Inc. TL670M far red labelled
Porcine Tubulin, Rhodamine Cytoskeleton, Inc. TL590M
Porcine Tubulin, Tubulin Protein Cytoskeleton, Inc. T240
Potassium Acetate Fisher Scientific BP364-500
Prime 95B sCMOS camera Photometric N/A
Quadrant Detector Sensor Head ThorLabs PDQ80A
Quikchange Lightning Kit Agilent Technologies 210518
Sodium Bicarbonate Fisher Scientific S233-500
Sodium Phosphate Dibasic Anhydrous Fisher Scientific BP332-500
Square Cover Glasses Corning 12-553-450 18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres Polysciences Inc. 24162-1
Superose-6 Column GE Healthcare 29-0915–96
TCEP Thermo Scientific 77720
TLA-100 Fixed-Angle Rotor Beckman Coulter 343840
Ultrasonic Cleaner (Sonicator) Vevor JPS-08A(DD) 304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution Vector Laboratories SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D S.C. Johnson SJN695237
DOWNLOAD MATERIALS LIST

References

  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. 생물학. 6 (1), 8 (2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227 (2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257 (2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544 (2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. 생물학. 5 (4), 55 (2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724 (2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659 (2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001 (2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131 (2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. . SMART – Servier Medical ART Available from: https://smart.servier.com/ (2022)
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695 (2018).

Tags

Microtubule BundlesCytoskeletal NetworksForce MeasurementOptical TrapTIRF MicroscopySingle-molecule ExperimentsProtein ConcentrationProtein DensityMitosisNeural DevelopmentMuscle ContractionCell MigrationStreptavidinNeutrAvidinCaseinBiotinylated MicrotubulesRhodamine MicrotubulesRigor Kinesin-coated BeadsReaction Buffer
check_url/kr/63819?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Palumbo, J., Tai, E., Forth, S. Directly Measuring Forces Within Reconstituted Active Microtubule Bundles. J. Vis. Exp. (183), e63819, doi:10.3791/63819 (2022).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image