아데노 관련 바이러스(AAV) 캡시드 변이체의 엔지니어링, 바코드 및 스크리닝을 통한 차세대 유전자 치료 벡터의 분리
Summary
AAV 펩타이드 디스플레이 라이브러리 생성 및 차세대 AAV 생성을 위한 새로운 특성을 가진 후보 물질의 바코딩을 통한 후속 검증.
Abstract
아데노 관련 바이러스(AAV)에서 파생된 유전자 전달 벡터는 임상 데이터를 장려하고 여러 AAV 유전자 요법을 승인함으로써 입증된 유전 질환 치료를 위한 가장 유망한 도구 중 하나입니다. AAV 벡터의 성공에 대한 두 가지 주요 이유는 (i) 뚜렷한 특성을 가진 다양한 자연 발생 바이러스 혈청형의 사전 분리와 (ii) 분자 공학 및 높은 처리량의 용도 변경을 위한 강력한 기술의 후속 확립입니다. 이러한 기술의 잠재력을 더욱 강화하는 것은 최근 DNA 및 RNA 수준에서 선택된 AAV 캡시드를 바코딩하기 위한 전략으로 구현되어 단일 동물의 모든 주요 기관 및 세포 유형에서 포괄적이고 평행한 생체 내 계층화를 허용합니다. 여기에서는 사용 가능한 캡시드 엔지니어링 기술의 다양한 무기고를 나타내기 위해 AAV 펩타이드 디스플레이를 사용하여 이러한 보완 방법을 포함하는 기본 파이프라인을 제시합니다. 따라서, 우리는 먼저 원하는 특성을 가진 후보의 생체 내 선택을 위한 AAV 펩타이드 디스플레이 라이브러리의 생성을 위한 중추적인 단계를 설명한 다음, 2차 생체 내 스크리닝을 위해 가장 흥미로운 캡시드 변이체를 바코드화하는 방법에 대한 시연을 설명합니다. 다음으로, NGS 데이터 분석 중 가장 중요한 단계에 대한 개요로 마무리하기 전에 바코드 증폭 및 어댑터 결찰을 포함한 차세대 염기서열 분석(NGS)을 위한 라이브러리 생성 방법론을 예시합니다. 여기에 보고된 프로토콜은 다재다능하고 적응력이 뛰어나기 때문에 연구자들은 이를 쉽게 활용하여 선호하는 질병 모델 및 유전자 치료 응용 분야에서 최적의 AAV 캡시드 변이체를 풍부하게 할 수 있습니다.
Introduction
유전자 전달 요법은 질병을 예방, 치료, 치료 또는 개선하기 위해 세포 유전 물질을 복구, 교체 또는 변경하기 위해 세포에 유전 물질을 도입하는 것입니다. 생체 내 및 생체 외 모두에서 유전자 전달은 비바이러스 및 바이러스의 서로 다른 전달 시스템에 의존합니다. 바이러스는 표적 세포를 효율적으로 형질도입하기 위해 자연적으로 진화했으며 전달 벡터로 사용될 수 있습니다. 유전자 치료에 사용되는 다양한 유형의 바이러스 벡터 중에서, 아데노 관련 바이러스는 병원성, 안전성, 낮은 면역원성, 그리고 가장 중요하게는 장기간의 비통합 발현을 유지하는 능력의 부족으로 인해 점점 더 많이 사용되고 있다 1,2,3. AAV 유전자 치료는 지난 10년 동안 상당한 성과를 거두었습니다. 유럽 의약품 청 (European Medicines Agency)과 미국 식품의 약국 (Food and Drug Administration)은 3,4. 혈우병, 근육, 심장, 신경계 질환과 같은 다양한 질병을 치료하기 위한 여러 임상 시험도 진행 중이다3. 유전자 치료 분야는 수십 년에 걸친 발전에도 불구하고 최근 몇 년 동안 일련의 차질을 빚어왔다.4 가장 중요한 것은 임상 시험5에서 용량 제한 독성으로 인해 사망이 보류되었는데, 이는 특히 근육과 같이 거대하거나 뇌와 같이 접근하기 어려운 조직에서 발생했다6.
현재 임상 시험에 사용되고 있는 AAV 벡터는 몇 가지 예외를 제외하고 천연 혈청형에 속한다1. AAV 엔지니어링은 우수한 장기 또는 세포 특이성과 효율성을 가진 벡터를 개발할 수 있는 기회를 제공합니다. 지난 20년 동안 펩타이드 디스플레이, 루프 스왑, 캡시드 DNA 셔플링, 오류가 발생하기 쉬운 PCR 및 표적 설계와 같은 여러 접근 방식이 성공적으로 적용되어 다양한 특성을 가진 개별 AAV 변이체 또는 라이브러리를 생성했습니다7. 그런 다음 이들은 다른 곳에서 검토된 바와 같이 원하는 특성을 가진 변이체를 선택하기 위해 여러 차례의 지시된 진화를 거칩니다 1,3. 모든 캡시드 진화 전략 중에서 펩타이드 디스플레이 AAV 라이브러리는 몇 가지 고유한 특성으로 인해 가장 널리 사용되었습니다: 상대적으로 생성하기 쉽고 높은 다양성과 높은 처리량 시퀀싱을 달성할 수 있어 진화를 추적할 수 있습니다.
최초의 성공적인 펩타이드 삽입 AAV 라이브러리는 거의 20년 전에 설명되었습니다. 첫 번째 중 하나에서, Perabo et al.8 은 무작위로 생성된 올리고뉴클레오티드 풀이 캡시드로부터 돌출된 3중 축에서 VP1 캡시드 단백질의 아미노산 587에 해당하는 위치의 플라스미드에 삽입된 변형된 AAV2 캡시드의 라이브러리를 구성했습니다. 아데노바이러스 동시 감염을 사용하여 AAV 라이브러리는 여러 차례의 선택을 통해 진화되었으며, 최종 재표적 변이체는 부모 AAV2에 불응성인 세포주를 형질도입할 수 있는 것으로 나타났다8. 그 후 얼마 지나지 않아 Müller et al.9 는 라이브러리 제작을 위한 2단계 시스템을 도입하여 프로토콜을 크게 개선했습니다. 처음에는 플라스미드 라이브러리가 아데노바이러스 헬퍼 플라스미드와 함께 키메라 캡시드를 포함하는 AAV 라이브러리를 생성하는 데 사용됩니다. 이 AAV 셔틀 라이브러리는 세포당 하나의 바이러스 게놈을 도입하는 것을 목표로 낮은 감염 다중도(MOI)에서 세포를 감염시키는 데 사용됩니다. 아데노 바이러스와의 동시 감염은 일치하는 게놈과 캡시드9를 가진 AAV의 생산을 보장합니다. 약 10 년 후, Dalkara10 은 생체 내 진화를 사용하여 7m8 변종을 만들었습니다. 이 변이체는 10개의 아미노산 삽입(LALGETTRPA)을 가지며, 그 중 3개는 링커로 작용하고, 유리체강내 주사 후 외부 망막을 효율적으로 표적으로 한다10. 이 조작된 캡시드는 지금까지 클리닉에 도착한 몇 안 되는 조작된 캡시드 중 하나이기 때문에 탁월한 성공 사례입니다11.
이 분야는 차세대 염기서열 분석(NGS) 기술의 도입으로 두 번째 성장을 경험했습니다. 2014년 Adachi et al.12와 2015년 Marsic et al.13의 두 간행물은 바코드화된 AAV 캡시드 라이브러리의 분포를 높은 정확도로 추적하는 NGS의 힘을 보여주었습니다. 몇 년 후, 바코드 영역의 NGS는 캡시드 진화를 따르기 위해 펩티드 삽입 영역에 적응되었습니다. Körbelin et al.14는 폐 표적 AAV2 기반 캡시드를 식별하기 위해 NGS 유도 스크리닝을 수행했습니다. NGS 분석은 선택 라운드 간의 농축 점수, 조직 특이성을 결정하기 위한 일반 특이도 점수, 마지막으로 결합 점수14의 세 가지 평가 점수를 계산하는 데 도움이 되었습니다. Gradinaru 실험실15는 같은 해에 Cre-recombination-based AAV 표적 진화 (CREATE) 시스템을 발표하여 세포 유형별 선택을 용이하게했습니다. 이 시스템에서 캡시드 라이브러리는 polyA 신호가 두 개의 loxP 사이트 옆에 있기 때문에 Cre-반전 가능한 스위치를 전달합니다. 그런 다음 AAV 라이브러리를 Cre 마우스에 주입하여 polyA 신호가 Cre+ 세포에서만 반전되어 캡시드 유전자 내의 정방향 프라이머와 역방향 PCR 프라이머의 결합을 위한 주형을 제공합니다. 이 매우 특이적인 PCR 구조를 통해 AAV-PHP를 식별할 수 있었습니다. 혈액뇌장벽을 통과할 수 있는 B 변이체15. 이 시스템은 M-CREATE(Multiplexed-CREATE)로 더욱 발전했으며, 여기서 NGS와 합성 라이브러리 생성은 파이프라인(16)에 통합되었다.
맥과이어 연구실(Maguire lab)17의 개선된 RNA 기반 버전인 iTransduce는 세포를 기능적으로 형질도입하고 게놈을 발현하는 캡시드의 DNA 수준에서 선택할 수 있습니다. 펩티드 디스플레이 라이브러리의 바이러스 게놈은 유비쿼터스 프로모터의 제어 하에 Cre 유전자 및 p41 프로모터의 제어 하에 캡시드 유전자를 포함한다. 라이브러리는 tdTomato의 상류에 loxP-STOP-loxP 카세트를 갖는 마우스에 주입됩니다. 바이러스 게놈을 발현하는 AAV 변이체로 형질도입된 세포는 Cre가 tdTomato를 발현하고, 세포 마커와 결합하여 분류 및 선택될 수 있다17. 유사하게, Nonnenmacher et al.18 및 Tabebordbar et al.19는 캡시드 유전자 라이브러리를 조직 특이적 프로모터의 제어 하에 두었습니다. 상이한 동물 모델에 주사한 후, 바이러스 RNA를 사용하여 캡시드 변이체를 분리하였다.
또 다른 방법은 바코드를 사용하여 캡시드 라이브러리에 태그를 지정하는 것입니다. Björklund lab20 은 바코드 펩타이드 삽입 캡시드 라이브러리에 이 접근 방식을 사용하고 바코드 합리적 AAV 벡터 진화(BRAVE)를 개발했습니다. 한 플라스미드에서 Rep2Cap 카세트는 ITR(Inverted Terminal Repeats) 측면에 노란색 형광 단백질(YFP) 발현, 바코드 태그가 부착된 이식유전자 옆에 클로닝됩니다. 캡 끝과 바코드 시작 부분 사이의 loxP 부위를 사용하여 시험관 내 Cre 재조합은 NGS에 충분히 작은 단편을 생성함으로써 펩타이드 삽입과 고유한 바코드(룩업 테이블, LUT)의 결합을 허용합니다. AAV 생산은 플라스미드 라이브러리를 사용하여 수행되고 mRNA에서 발현된 바코드는 생체 내 적용 후 NGS20으로 다시 스크리닝됩니다. 캡시드 라이브러리가 전체 캡시드 유전자의 변이체(즉, 섞인 라이브러리)로 구성된 경우 긴 읽기 시퀀싱을 사용해야 합니다. 여러 그룹이 바코드를 사용하여 이러한 다양한 라이브러리에 태그를 지정했으며, 이를 통해 더 높은 판독 깊이의 NGS를 사용할 수 있습니다. Kay lab21 은 캡 polyA 신호의 다운스트림에 바코드가 있는 매우 다양한 캡 시드 셔플 라이브러리에 태그를 지정했습니다. 첫 번째 단계에서, 바코드화된 플라스미드 라이브러리가 생성되었고, 섞인 캡시드 유전자 라이브러리가 그 안에 클로닝되었다. 그런 다음 MiSeq(짧은 읽기, 더 높은 읽기 깊이) 및 PacBio(긴 읽기, 더 낮은 읽기 깊이) NGS와 Sanger 시퀀싱의 조합을 사용하여 LUT21을 생성했습니다. 2019년에 Church Lab22 의 Ogden과 동료들은 모든 위치에서 단일 지점 돌연변이, 삽입 및 결실이 있는 라이브러리를 사용하여 여러 기능에 대한 AAV2 캡시드 적합성을 설명했으며, 이는 궁극적으로 기계 유도 설계를 가능하게 했습니다. 라이브러리의 생성을 위해 캡시드 유전자의 더 작은 단편을 합성하고, 바코드로 태그를 지정하고, 차세대 시퀀싱한 다음, 전체 캡시드 유전자에 클로닝했습니다. NGS 데이터는 LUT를 생성하는 데 사용되었습니다. 그런 다음 라이브러리는 바코드와 짧은 판독 시퀀싱만을 사용하여 스크리닝되었으며, 이는 차례로 더 높은 판독 깊이(22)를 허용합니다.
바코드 라이브러리는 캡시드 라이브러리를 여러 차례 선택하거나 캡시드 진화 연구와 무관하게 알려진 자연적 및 조작된 변이체 풀을 스크리닝하는 데 주로 사용되었습니다. 이러한 라이브러리의 장점은 여러 캡시드를 스크리닝하는 동시에 동물 수를 줄이고 동물 간의 변동을 최소화할 수 있다는 것입니다. 이 기술을 AAV 분야에 도입한 첫 번째 연구는 거의 10년 전에 발표되었습니다. Nakai lab12 는 한 쌍의 12-뉴클레오티드 바코드를 사용하여 AAV9의 VP1에서 아미노산 356 내지 736을 포함하는 191개의 이중 알라닌 돌연변이체에 태그를 붙였습니다. NGS를 사용하여, 라이브러리는 갈락토오스 결합 및 기타 특성에 대해 생체 내에서 스크리닝되었다12. Marsic과 동료들은 1 년 후 이중 막대 분석을 사용하여 AAV 변이체의 생체 분포를 설명했다13. 인간이 아닌 영장류에 대한 보다 최근의 연구에서는 서로 다른 전달 경로를 사용하여 29개의 캡시드의 중추신경계 내 생체 분포를 비교했습니다23. 우리 연구실은 최근 천연 및 엔지니어링 AAV를 포함하는 183 가지 변형의 바코드 AAV 라이브러리 스크린을 발표했습니다. DNA 및 RNA 수준에 대한 이러한 스크리닝은 마우스에서 고도의 근친화성 AAV 변이체(24)를 식별하게 했으며, 마우스 뇌(25)에서 높은 세포 유형 특이성을 나타내는 다른 변이체를 식별했습니다.
여기에서는 이 작업에 사용된 방법론을 설명하고 AAV 펩타이드 디스플레이 라이브러리의 스크리닝을 포함하도록 확장합니다. 이것은 AAV2 펩타이드 디스플레이 라이브러리의 생성, 정량화를 위한 디지털 액적 PCR(dd-PCR) 방법, 그리고 마지막으로 부분적으로 Weinmann과 동료24의 작업을 기반으로 AAV 변이체를 분석하기 위한 NGS 파이프라인으로 구성됩니다. 마지막으로, 동일한 간행물에 사용된 바코드 AAV 라이브러리 및 NGS 파이프라인의 생성에 대한 설명이 제공됩니다.
Protocol
Representative Results
Discussion
이 프로토콜에서는 펩타이드 디스플레이 AAV 캡시드 엔지니어링 및 바코드 AAV 라이브러리 스크리닝, 라이브러리 구성 및 캡시드 성능의 생물정보학적 분석에 필요한 단계를 간략하게 설명합니다. 이 프로토콜은 대부분의 바이러스학 실험실이 분자 생물학 기술에 대한 숙련도에 맞게 프로그래밍 기술이 뒤쳐져 있기 때문에 이러한 유형의 라이브러리에 대한 생물정보학적 분석을 용이하게 하는 단…
Disclosures
The authors have nothing to disclose.
Acknowledgements
D.G.는 DFG 공동 연구 센터 SFB1129 (Projektnummer 240245660) 및 TRR179 (Projektnummer 272983813)와 독일 감염 연구 센터 (DZIF, BMBF; TTU-HIV 04.819).
Materials
| Amplification primer | ELLA Biotech (Munich, Germany) | – | Second-strand synthesis of oligonucleotide insert |
| Agilent DNA 1000 Reagents | Agilent Technologies (Santa Clara, CA, USA) | 5067-1504 | DNA fragment validation |
| Agilent 2100 Bioanalyzer System | Agilent Technologies (Santa Clara, CA, USA) | G2938C | DNA fragment validation |
| AllPrep DNA/RNA Mini Kit | Qiagen (Venlo, Netherlands) | 80204 | DNA/RNA extraction |
| Agilent DNA 1000 Reagents | Agilent Technologies (Santa Clara, CA, USA) | 5067-1504 | NGS Library preparation |
| Agilent 2100 Bioanalyzer System | Agilent Technologies (Santa Clara, CA, USA) | G2938C | NGS Library preparation |
| BC-seq fw: | IDT (San Joce, CA, CA, USA) | ATCACTCTCGGCATGGACGAGC | NGS Library preparation |
| BC-seq rv: | IDT (San Joce, CA, CA, USA) | GGCTGGCAACTAGAAGGCACA | NGS Library preparation |
| β-Mercaptoethanol | Millipore Sigma (Burlington, MA, USA) | 44-420-3250ML | DNA/RNA extraction |
| BglI | New England Biolabs (Ipswich, MA, USA) | R0143 | Digestion of double-stranded insert |
| C1000 Touch Thermal Cycler | Bio-Rad (Hercules, CA, USA) | 1851196 | dd-PCR cycler |
| dNTPS | New England Biolabs (Ipswich, MA, USA) | N0447S | NGS Library preparation |
| ddPCR Supermix for probes (no dUTP) | Bio-Rad (Hercules, CA, USA) | 1863024 | dd-PCR supermix |
| Droplet Generation Oil for Probes | Bio-Rad (Hercules, CA, USA) | 1863005 | dd-PCR droplet generation oil |
| DG8 Cartridges for QX100 / QX200 Droplet Generator | Bio-Rad (Hercules, CA, USA) | 1864008 | dd-PCR droplet generation cartridge |
| DG8 Cartridge Holder | Bio-Rad (Hercules, CA, USA) | 1863051 | dd-PCR cartridge holder |
| Droplet Generator DG8 Gasket | Bio-Rad (Hercules, CA, USA) | 1863009 | dd-PCR cover for cartridge |
| ddPCR Plates 96-Well, Semi-Skirted | Bio-Rad (Hercules, CA, USA) | 12001925 | dd-PCR 96-well plate |
| E.cloni 10G SUPREME Electrocompetent Cells | Lucigen (Middleton, WI, USA) | 60081-1 | Electrocompetent cells |
| Electroporation cuvettes, 1mm | Biozym Scientific (Oldendorf, Germany) | 748050 | Electroporation |
| GAPDH primer/probe mix | Thermo Fischer Scientific (Waltham, MA, USA) | Mm00186825_cn | Taqman qPCR primer |
| Genepulser Xcell | Bio-Rad (Hercules, CA, USA) | 1652660 | Electroporation |
| High-Capacity cDNA Reverse Transcription Kit | Applied Biosystems (Waltham, MA, USA) | 4368814 | cDNA reverse transcription |
| ITR_fw | IDT (San Joce, CA, USA) | GGAACCCCTAGTGATGGAGTT (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR primer |
| ITR_rv | IDT (San Joce, CA, USA) | CGGCCTCAGTGAGCGA (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR primer |
| ITR_probe | IDT (San Joce, CA, USA) | HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1 (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR probe |
| Illumina NextSeq 500 system | Illumina Inc (San Diego, CA, USA) | SY-415-1001 | NGS Library sequencing |
| KAPA HiFi HotStart ReadyMix (2X)* | Roche AG (Basel, Switzerland) | KK2600 07958919001 | NGS sample prepration |
| MagnaBot 96 Magnetic Separation Device | Promega GmbH (Madison, WI, USA) | V8151 | Sample prepration for NGS library |
| NanoDrop 2000 spectrophotometer | Thermo Fischer Scientific (Waltham, MA, USA) | ND-2000 | Digestion of double-stranded insert |
| NGS_frw | Sigma-Aldrich (Burlinght, MA, USA) | GTT CTG TAT CTA CCA ACC TC | NGS primer |
| NGS_rev | Sigma-Aldrich (Burlinght, MA, USA) | CGC CTT GTG TGT TGA CAT C | NGS primer |
| NextSeq 500/550 High Output Kit (75 cycles) | Illumina Inc (San Diego, CA, USA) | FC-404-2005 | NGS Library sequencing |
| Ovation Library System for Low Complexity Samples Kit | NuGEN Technologies, Inc. (San Carlos, CA, USA) | 9092-256 | NGS Library preparation |
| PX1 Plate Sealer | Bio-Rad (Hercules, CA, USA) | 1814000 | dd-PCR plate sealer |
| Pierceable Foil Heat Seal | Bio-Rad (Hercules, CA, USA) | 1814040 | dd-PCR sealing foil |
| Phusion High-Fidelity DNA-Polymerase | Thermo Fischer Scientific (Waltham, MA, USA) | F530S | Second-strand synthesis of oligonucleotide insert |
| PEI MAX – Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) | Polysciences, Inc. (Warrington, PA, USA) | 24765-1G | AAV library preparation |
| ProNex Size-Selective Purification System | Promega GmbH (Madison, WI, USA) | NG2002 | Sample prepration for NGS library |
| Phusion Hot Start II Polymerase | Thermo Fischer Scientific (Waltham, MA, USA) | F549L | NGS Library preparation |
| Proteinase K | Roche AG (Basel, Switzerland) | 5963117103 | DNA/RNA extraction |
| pRep2Cap2_PIS | ITR-Rep2Cap2-ITR vector. Peptide insertion site within the Cap2 ORF, manufactured/prepared in the lab | ||
| QX200 Droplet Generator | Bio-Rad (Hercules, CA, USA) | 1864002 | dd-PCR droplet generator |
| QX200 Droplet Reader | Bio-Rad (Hercules, CA, USA) | 1864003 | dd-PCR droplet analysis |
| QIAquick Nucleotide Removal Kit | Qiagen (Venlo, Netherlands) | 28306 | Second-strand synthesis of oligonucleotide insert purification |
| QIAquick Gel Extraction Kit | Qiagen (Venlo, Netherlands) | 28704 | Plasmid vector purification |
| QIAGEN Plasmid Maxi Kit | Qiagen (Venlo, Netherlands) | 12162 | Plasmid library DNA preparation |
| Qiaquick PCR Purification kit | Qiagen (Venlo, Netherlands) | 28104 | Sample prepration for NGS library |
| Qubit fluorometer | Invitrogen (Waltham, MA, USA) | Q32857 | NGS Library preparation |
| Qubit dsDNA HS | Thermo Fischer Scientific (Waltham, MA, USA) | Q32851 | NGS Library preparation |
| QuantiFast PCR Master Mix | Qiagen (Venlo, Netherlands) | 1044234 | Taqman qPCR |
| rep_fw | IDT (San Joce, CA, USA) | AAGTCCTCGGCCCAGATAGAC | dd-PCR primer |
| rep_rv | IDT (San Joce, CA, USA) | CAATCACGGCGCACATGT | dd-PCR primer |
| rep_probe | IDT (San Joce, CA, USA) | FAM-TGATCGTCACCTCCAACA-BHQ1 | dd-PCR probe |
| RNase-free DNase | Qiagen (Venlo, Netherlands) | 79254 | DNA/RNA extraction |
| SfiI | New England Biolabs (Ipswich, MA, USA) | R0123 | Digestion of vector |
| 5 mm, steel Beads | Qiagen (Venlo, Netherlands) | 69989 | DNA/RNA extraction |
| TRIMER-oligonucleotides | ELLA Biotech (Munich, Germany) | – | Degenerate oligonucleotide |
| T4 Ligase | New England Biolabs (Ipswich, MA, USA) | M0202L | Plasmid library ligation |
| TissueLyserLT | Qiagen (Venlo, Netherlands) | 85600 | DNA/RNA extraction |
| YFP_fw | IDT (San Joce, CA, USA) | GAGCGCACCATCTTCTTCAAG | dd-PCR primer |
| YFP_rv | IDT (San Joce, CA, USA) | TGTCGCCCTCGAACTTCAC | dd-PCR primer |
| YFP_probe | IDT (San Joce, CA, USA) | FAM-ACGACGGCAACTACA-BHQ1 | dd-PCR probe |
| Zymo DNA Clean & Concentrator-5 (Capped) | Zymo research (Irvine, CA, USA) | D4013 | Vector and Ligation purification |
References
- Wang, D., Tai, P. W. L., Gao, G. Adeno-associated virus vector as a platform for gene therapy delivery. Nature Reviews Drug Discovery. 18 (5), 358-378 (2019).
- Muhuri, M., Levy, D. I., Schulz, M., McCarty, D., Gao, G. Durability of transgene expression after rAAV gene therapy. Molecular Therapy. 30 (4), 1364-1380 (2022).
- Li, C., Samulski, R. J. Engineering adeno-associated virus vectors for gene therapy. Nature Reviews Genetics. 21 (4), 255-272 (2020).
- Kuzmin, D. A., et al. The clinical landscape for AAV gene therapies. Nature Reviews Drug Discovery. 20 (3), 173-174 (2021).
- Mullard, A. Gene therapy community grapples with toxicity issues, as pipeline matures. Nature Reviews Drug Discovery. 20 (11), 804-805 (2021).
- Nature Biotechnology. Gene therapy at the crossroads. Nature Biotechnology. 40 (5), 621 (2022).
- Becker, P., et al. Fantastic AAV Gene Therapy Vectors and How to Find Them-Random Diversification, Rational Design and Machine Learning. Pathogens. 11 (7), 756 (2022).
- Perabo, L., et al. In vitro selection of viral vectors with modified tropism: the adeno-associated virus display. Molecular Therapy. 8 (1), 151-157 (2003).
- Muller, O. J., et al. Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors. Nature Biotechnology. 21 (9), 1040-1046 (2003).
- Dalkara, D., et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Science Translational Medicine. 5 (189), (2013).
- Sahel, J. A., et al. Partial recovery of visual function in a blind patient after optogenetic therapy. Nature Medicine. 27 (7), 1223-1229 (2021).
- Adachi, K., Enoki, T., Kawano, Y., Veraz, M., Nakai, H. Drawing a high-resolution functional map of adeno-associated virus capsid by massively parallel sequencing. Nature Communications. 5, 3075 (2014).
- Marsic, D., Mendez-Gomez, H. R., Zolotukhin, S. High-accuracy biodistribution analysis of adeno-associated virus variants by double barcode sequencing. Molecular Therapy-Methods & Clinical Development. 2, 15041 (2015).
- Korbelin, J., et al. Pulmonary targeting of adeno-associated viral vectors by next-generation sequencing-guided screening of random capsid displayed peptide libraries. Molecular Therapy. 24 (6), 1050-1061 (2016).
- Deverman, B. E., et al. Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain. Nature Biotechnology. 34 (2), 204-209 (2016).
- Ravindra Kumar, S., et al. Multiplexed Cre-dependent selection yields systemic AAVs for targeting distinct brain cell types. Nature Methods. 17 (5), 541-550 (2020).
- Hanlon, K. S., et al. Selection of an efficient AAV vector for robust CNS transgene expression. Molecular Therapy-Methods & Clinical Development. 15, 320-332 (2019).
- Nonnenmacher, M., et al. Rapid evolution of blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning. Molecular Therapy-Methods & Clinical Development. 20, 366-378 (2021).
- Tabebordbar, M., et al. Directed evolution of a family of AAV capsid variants enabling potent muscle-directed gene delivery across species. Cell. 184 (19), 4919-4938 (2021).
- Davidsson, M., et al. A systematic capsid evolution approach performed in vivo for the design of AAV vectors with tailored properties and tropism. Proceedings of the National Academy of Sciences. 116 (52), 27053-27062 (2019).
- Pekrun, K., et al. Using a barcoded AAV capsid library to select for clinically relevant gene therapy vectors. Journal of Clinical Investigation Insight. 4 (22), (2019).
- Ogden, P. J., Kelsic, E. D., Sinai, S., Church, G. M. Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design. Science. 366 (6469), 1139-1143 (2019).
- Kondratov, O., et al. A comprehensive study of a 29-capsid AAV library in a non-human primate central nervous system. Molecular Therapy. 29 (9), 2806-2820 (2021).
- Weinmann, J., et al. Identification of a myotropic AAV by massively parallel in vivo evaluation of barcoded capsid variants. Nature Communications. 11 (1), 5432 (2020).
- Kremer, L. P. M., et al. High throughput screening of novel AAV capsids identifies variants for transduction of adult NSCs within the subventricular zone. Molecular Therapy-Methods & Clinical Development. 23, 33-50 (2021).
- Borner, K., et al. Pre-arrayed pan-AAV peptide display libraries for rapid single-round screening. Molecular Therapy. 28 (4), 1016-1032 (2020).
- Kienle, E., et al. Engineering and evolution of synthetic adeno-associated virus (AAV) gene therapy vectors via DNA family shuffling. Journal of Visualized Experiments. (62), e3819 (2012).
- Furuta-Hanawa, B., Yamaguchi, T., Uchida, E. Two-dimensional droplet digital PCR as a tool for titration and integrity evaluation of recombinant adeno-associated viral vectors. Human Gene Therapy Methods. 30 (4), 127-136 (2019).
- Lyons, E., Sheridan, P., Tremmel, G., Miyano, S., Sugano, S. Large-scale DNA barcode library generation for biomolecule identification in high-throughput screens. Scientific Reports. 7 (1), 13899 (2017).
- Korbelin, J., et al. Optimization of design and production strategies for novel adeno-associated viral display peptide libraries. Gene Therapy. 24 (8), 470-481 (2017).
- Korbelin, J., Trepel, M. How to successfully screen random adeno-associated virus display peptide libraries in vivo. Human Gene Therapy Methods. 28 (3), 109-123 (2017).
- Herrmann, A. K., et al. A robust and all-inclusive pipeline for shuffling of adeno-associated viruses. American Chemical Society Synthetic Biology. 8 (1), 194-206 (2019).
- Choudhury, S. R., et al. In vivo selection yields AAV-B1 Capsid for central nervous system and muscle gene therapy. Molecular Therapy. 24 (7), 1247-1257 (2016).
- Buschmann, T., Bystrykh, L. V. Levenshtein error-correcting barcodes for multiplexed DNA sequencing. BMC Bioinformatics. 14, 272 (2013).
- Buschmann, T. DNABarcodes: an R package for the systematic construction of DNA sample tags. Bioinformatics. 33 (6), 920-922 (2017).
- Li, B., et al. A comprehensive mouse transcriptomic BodyMap across 17 tissues by RNA-seq. Scientific Reports. 7 (1), 4200 (2017).
- Clarner, P., et al. Development of a one-step RT-ddPCR method to determine the expression and potency of AAV vectors. Molecular Therapy-Methods & Clinical Development. 23, 68-77 (2021).
- Zolotukhin, S., Vandenberghe, L. H. AAV capsid design: A Goldilocks challenge. Trends in Molecular Medicine. 28 (3), 183-193 (2022).
- Brown, D., et al. deep parallel characterization of AAV tropism and AAV-mediated transcriptional changes via single-cell RNA sequencing. Frontiers in Immunology. 12, 730825 (2021).
