JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
자동 번역
Please note that all translations are automatically generated. Click here for the English version.
생물학

마우스 자궁에서 3D 자궁 내막 오가노이드 확립

Published: January 06, 2023
doi:
10.3791/64448
, , , , ,
1Department of Pathology & Immunology,Baylor College of Medicine, 2Center for Drug Discovery,Baylor College of Medicine, 3Departments of Molecular Virology and Microbiology and Medicine,Baylor College of Medicine

Summary

이 프로토콜은 유전자 발현 및 조직학적 분석을 위한 마우스 자궁내막 상피 오가노이드를 확립하는 방법론을 설명합니다.

Abstract

자궁 내막 조직은 자궁의 내강을 따라 늘어서 있으며 에스트로겐과 프로게스테론의 주기적 통제하에 있습니다. 그것은 내강 및 선 상피, 간질 구획, 혈관 네트워크 및 복잡한 면역 세포 집단으로 구성된 조직입니다. 마우스 모델은 자궁 내막을 연구하는 강력한 도구였으며 이식, 태반 및 암을 제어하는 중요한 메커니즘을 밝혀 냈습니다. 최근 3D 자궁내막 오가노이드 배양의 개발은 자궁내막 생물학의 기초가 되는 신호 전달 경로를 해부하는 최첨단 모델을 제시합니다. 유전자 조작 마우스 모델에서 자궁내막 오가노이드를 확립하고, 전사체를 분석하고, 단일 세포 분해능으로 형태를 시각화하는 것은 자궁내막 질환 연구에 중요한 도구입니다. 이 논문은 마우스에서 자궁 내막 상피의 3D 배양을 확립하는 방법을 설명하고 유전자 발현을 정량화하고 오가노이드의 조직학을 분석하는 기술을 설명합니다. 목표는 자궁내막 상피 오가노이드의 유전자 발현 및 형태학적 특성을 확립, 배양 및 연구하는 데 사용할 수 있는 리소스를 제공하는 것입니다.

Introduction

자궁강의 내부 안감 점막 조직인 자궁내막은 여성의 생식 건강에 중요한 역할을 하는 독특하고 매우 역동적인 조직입니다. 생식 수명 동안 자궁 내막은 난소 호르몬 인 에스트로겐과 프로게스테론의 공동 작용에 의해 조정 된 수백 번의 증식, 분화 및 분해주기를 겪을 가능성이 있습니다. 유전자 조작 마우스에 대한 연구는 호르몬에 대한 자궁 내막 반응과 배아 이식, 기질 세포 탈락 및 임신 조절을 뒷받침하는 기본적인 생물학적 메커니즘을 밝혀 냈습니다1. 그러나 시험관 내 연구는 전통적인 2D 세포 배양 2,3에서 형질전환되지 않은 일차 마우스 자궁내막 조직을 유지하는 데 어려움이 있기 때문에 제한적이었습니다. 최근 3D 장기 시스템 또는 오가노이드와 같은 자궁내막 조직 배양의 발전은 자궁내막 세포 재생 및 분화를 제어하는 생물학적 경로를 조사할 수 있는 새로운 기회를 제공합니다. 마우스 및 인간 자궁내막 오가노이드 시스템은 다양한 매트릭스4,5에 캡슐화된 순수한 자궁내막 상피로부터 개발되었으며, 인간 자궁내막은 스캐폴드가 없는 상피/기질 공동 배양6,7로, 보다 최근에는 콜라겐 캡슐화된 상피/기질 집합체8로 배양되었습니다. . 상피 오가노이드 배양의 성장 및 재생 잠재력은 오가노이드 4,5,9의 성장 및 재생을 최대화하기 위해 경험적으로 결정된 성장 인자 및 소분자 억제제의 정의된 칵테일에 의해 뒷받침됩니다. 또한, 자궁내막 오가노이드를 동결 및 해동하는 능력은 향후 연구를 위해 생쥐와 인간의 자궁내막 오가노이드의 장기 뱅킹을 허용합니다.

유전자 조작 마우스는 임신 초기와 탈락을 제어하는 복잡한 신호 전달 경로를 밝혀 냈으며 임신 손실, 자궁 내막 암 및 자궁 내막증의 모델로 사용되었습니다. 이러한 유전 연구는 여성 생식 조직에서 특이적으로 활성인 cre 재조합 효소를 사용하여 loxP 측면 대립 유전자 ( “플록스”)의 세포 특이 적 결실로 크게 달성되었습니다. 이러한 마우스 모델에는 자궁 내막 상피 및 기질 조직에서 강력한 재조합 효소 활성을 갖는 널리 사용되는 프로게스테론 수용체 -cre10, 성인 마우스에서 자궁 내막 상피 재조합을 유도하는 락토페린 i-cre11 또는 뮐러 유래 조직에서 상피 특이 적 결실을 유발하는 Wnt7a-cre 12가 포함됩니다. . 유전자 조작 마우스 모델에서 자궁내막 조직을 3D 오가노이드로 배양하는 것은 자궁내막 생물학을 조사하고 자궁내막 세포 재생 및 분화를 제어하는 성장 인자 및 신호 전달 경로의 식별을 용이하게 할 수 있는 훌륭한 기회를 제공했습니다13,14. 마우스 자궁 내막 조직의 분리 및 배양 방법은 문헌에 기재되어 있으며 자궁 내막 상피 유기체의 후속 배양을위한 자궁 상피의 분리를위한 다양한 효소 전략의 사용을보고한다4. 이전 문헌이 자궁내막 상 피 오가노이드 배양 프로토콜 4,5,6에 대한 중요한 프레임워크를 제공했지만, 이 백서는 이러한 오가노이드를 생성, 유지, 처리 및 분석하기 위한 명확하고 포괄적인 방법을 제공합니다. 이러한 기술의 표준화는 여성 생식 생물학 분야의 발전을 가속화하는 데 중요합니다. 여기에서, 우리는 겔 매트릭스 스캐폴드에서 자궁내막 오가노이드의 후속 배양을 위한 마우스 자궁내막 상피 조직의 효소적 및 기계적 정제를 위한 상세한 방법론을 보고한다. 또한 겔 매트릭스 캡슐화 마우스 자궁내막 상피 오가노이드의 다운스트림 조직학적 및 분자 분석을 위한 방법론을 설명합니다.

Protocol

마우스 취급 및 실험 연구는 Baylor College of Medicine의 기관 동물 관리 및 사용위원회 (IACUC)에서 승인 한 프로토콜과 실험실 동물의 관리 및 사용을위한 NIH 가이드에서 수립 한 지침에 따라 수행되었습니다. 1. 효소 및 기계적 방법을 사용한 마우스에서 자궁 상피 분리 참고: 이 섹션에서는 겔 매트릭스 스캐폴드를 사용하여 마우스로부터 상피 자궁…

Representative Results

마우스 자궁내막 오가노이드의 위상차 이미지첨부된 프로토콜에 설명된 대로 WT 마우스 자궁내막 상피에서 오가노이드를 확립했습니다( 그림 1의 다이어그램 참조). 마우스 자궁 내막 상피의 효소 해리에 이어, 상피 시트를 자궁 기질 세포로부터 기계적으로 분리하고 콜라게나제로 더 해리시켜 단일 세포 현탁액을 생성시켰다. 올바르게 수행되면 이 상피 및 …

Discussion

여기에서는 마우스 자궁내막에서 자궁내막 상피 오가노이드를 생성하는 방법과 다운스트림 분석에 일상적으로 사용되는 프로토콜에 대해 설명합니다. 자궁내막 오가노이드는 자궁내막증, 자궁내막암 및 착상 실패와 같은 자궁내막 관련 질병을 제어하는 메커니즘을 연구하는 강력한 도구입니다. 2017년에 발표된 획기적인 연구에서는 마우스와 인간 상피 4,5<sup class="xref"…

Disclosures

The authors have nothing to disclose.

Acknowledgements

스테파니 팡가스 박사와 마틴 M. 마추크 박사(M.M.M.)에게 우리 원고를 비판적으로 읽고 편집해 주신 데 대해 감사드립니다. 연구는 유니스 케네디 슈라이버 국립 아동 건강 및 인간 발달 연구소 보조금 R00-HD096057 (DM), R01-HD105800 (DM), R01-HD032067 (M.M.M.) 및 R01-HD110038 (M.M.M.) 및 NCI-P30 암 센터 지원 보조금 (NCI-CA125123). Diana Monsivais, Ph.D. Burroughs Wellcome Fund에서 차세대 임신 상을 수상했습니다.

Materials

Organoid Media Formulation
Name Company Catalog Number Final concentration
Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free Corning 354230 100%
Trypsin from Bovine Pancreas Sigma Aldrich T1426-1G 1%
Advanced DMEM/F12 Life Technologies 12634010 1X
N2 supplement Life Technologies 17502048 1X
B-27™ Supplement (50X), minus vitamin A Life Technologies 12587010 1X
Primocin Invivogen ant-pm-1 100 µg/mL
N-Acetyl-L-cysteine Sigma Aldrich A9165-5G 1.25 mM
L-glutamine Life Technologies 25030024 2 mM
Nicotinamide Sigma Aldrich N0636-100G 10 nM
ALK-4, -5, -7 inhibitor, A83-01 Tocris 2939 500 nM
Recombinant human EGF Peprotech AF-100-15 50 ng/mL
Recombinant human Noggin Peprotech 120-10C 100 ng/mL
Recombinant human Rspondin-1 Peprotech 120-38 500 ng/mL
Recombinant human FGF-10 Peprotech 100-26 100 ng/mL
Recombinant human HGF Peprotech 100-39 50 ng/mL
WNT3a R&D systems 5036-WN 200 ng/mL
Other supplies and reagents
Name Company Catalog Number Final concentration
Collagenase from Clostridium histolyticum Sigma Aldrich C0130-1G 5 mg/mL
Deoxyribonuclease I from bovine pancreas Sigma Aldrich DN25-100MG 2 mg/mL
DPBS, no calcium, no magnesium ThermoFisher 14190-250 1X
HBSS, no calcium, no magnesium ThermoFisher 14170112 1X
Falcon Polystyrene Microplates (24-Well) Fisher Scientific #08-772-51
Falcon Polystyrene Microplates (12-Well) Fisher Scientific #0877229
Falcon Cell Strainers, 40 µm Fisher Scientific #08-771-1
Direct-zol RNA MiniPrep (50 µg) Genesee Scientific 11-331
Trizol reagent Invitrogen 15596026
DMEM/F-12, HEPES, no phenol red ThermoFisher 11039021
Fetal Bovine Serum, Charcoal stripped Sigma Aldrich F6765-500ML 2%
Estratiol (E2) Sigma Aldrich E1024-1G 10 nM
Formaldehyde 16% in aqueous solution, EM Grade VWR 15710 4%
Epredia Cassette 1 Slotted Tissue Cassettes Fisher Scientific 1000961
Epredia Stainless-Steel Embedding Base Molds Fisher Scientific 64-010-15 
Ethanol, 200 proof (100%) Fisher Scientific 22-032-601 
Histoclear Fisher Scientific 50-899-90147
Permount Mounting Medium Fisher Scientific 50-277-97
Epredia Nylon Biopsy Bags Fisher Scientific 6774010
HistoGel Specimen Processing Gel VWR 83009-992
Hematoxylin solution Premium VWR 95057-844
Eosin Y (yellowish) solution Premium VWR 95057-848
TBS Buffer, 20X, pH 7.4 GenDEPORT T8054 1X
TBST (10X), pH 7.4 GenDEPORT T8056 1X
Citric acid  Sigma Aldrich C0759-1KG
Sodium citrate tribasic dihydrate Sigma Aldrich S4641-500G
Tween20 Fisher Scientific BP337-500 
Bovine Serum Albumin (BSA) Sigma Aldrich A2153-100G 3%
DAPI Solution (1 mg/mL) ThermoFisher 62248 1:1000 dilution
VECTASHIELD Antifade Mounting Medium Vector Labs H-1000-10
Clear Nail Polish Fisher Scientific NC1849418
Fisherbrand Superfrost Plus Microscope Slides Fisher Scientific 22037246
VWR Micro Cover Glasses VWR 48393-106
SuperScript VILO Master Mix ThermoFisher 11755050
SYBR Green PCR Master Mix ThermoFisher 4364346
Krt8 Antibody (TROMA-I)  DSHB TROMA-I  1:50 dilution
Vimentin Antobody Cell Signaling 5741S 1:200 dilution
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 594		 ThermoFisher A-21209 1:250 dilution
Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 488		 ThermoFisher A-21206 1:250 dilution
ZEISS Stemi 508 Stereo Microscope ZEISS
ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera ZEISS
Primer Sequence Forward (5'-3') Reverse (5'-3') _
Lipocalin 2 (Lcn2) GCAGGTGGTACGTTGTGGG CTCTTGTAGCTCATAGATGGTGC
Lactoferrin (Ltf) TGAGGCCCTTGGACTCTGT ACCCACTTTTCTCATCTCGTTC
Progesterone (Pgr) CCCACAGGAGTTTGTCAAGCTC TAACTTCAGACATCATTTCCGG
Glyceraldehyde 3 phosphate dehydrogenase (Gapdh) CAATGTGTCCGTCGTGGATCT GCCTGCTTCACCACCTTCTT
DOWNLOAD MATERIALS LIST

References

  1. Wang, H., Dey, S. K. Roadmap to embryo implantation: clues from mouse models. Nature Reviews Genetics. 7 (3), 185-199 (2006).
  2. Hibaoui, Y., Feki, A. Organoid models of human endometrial development and disease. Frontiers in Cell and Developmental Biology. 8, 84 (2020).
  3. Rawlings, T. M., Makwana, K., Tryfonos, M., Lucas, E. S. Organoids to model the endometrium: implantation and beyond. Reproduction & Fertility. 2 (3), 85-101 (2021).
  4. Boretto, M., et al. Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability. Development. 144 (10), 1775-1786 (2017).
  5. Turco, M. Y., et al. Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nature Cell Biology. 19 (5), 568-577 (2017).
  6. Murphy, A. R., Wiwatpanit, T., Lu, Z., Davaadelger, B., Kim, J. J. Generation of multicellular human primary endometrial organoids. Journal of Visualized Experiments. (152), e60384 (2019).
  7. Wiwatpanit, T., et al. Scaffold-free endometrial organoids respond to excess androgens associated with polycystic ovarian syndrome. The Journal of Clinical Endocrinology and Metabolism. 105 (3), 769-780 (2020).
  8. Rawlings, T. M., et al. Modelling the impact of decidual senescence on embryo implantation in human endometrial assembloids. Elife. 10, 69603 (2021).
  9. Lou, L., Kong, S., Sun, Y., Zhang, Z., Wang, H. Human endometrial organoids: recent research progress and potential applications. Frontiers in Cell and Developmental Biology. 10, 844623 (2022).
  10. Soyal, S. M., et al. Cre-mediated recombination in cell lineages that express the progesterone receptor. Genesis. 41 (2), 58-66 (2005).
  11. Daikoku, T., et al. Lactoferrin-iCre: a new mouse line to study uterine epithelial gene function. Endocrinology. 155 (7), 2718-2724 (2014).
  12. Winuthayanon, W., Hewitt, S. C., Orvis, G. D., Behringer, R. R., Korach, K. S. Uterine epithelial estrogen receptor alpha is dispensable for proliferation but essential for complete biological and biochemical responses. Proceedings of the National Academy of Sciences. 107 (45), 19272-19277 (2010).
  13. Seishima, R., et al. Neonatal Wnt-dependent Lgr5 positive stem cells are essential for uterine gland development. Nature Communications. 10 (1), 5378 (2019).
  14. Syed, S. M., et al. Endometrial Axin2(+) cells drive epithelial homeostasis, regeneration, and cancer following oncogenic transformation. Cell Stem Cell. 26 (1), 64-80 (2020).
  15. Caligioni, C. S. Assessing reproductive status/stages in mice. Current Protocols in Neuroscience. , (2009).
  16. Fitzgerald, H. C., Schust, D. J., Spencer, T. E. In vitro models of the human endometrium: evolution and application for women’s health. Biology of Reproduction. 104 (2), 282-293 (2021).
  17. Hewitt, S. C., et al. Progesterone signaling in endometrial epithelial organoids. Cells. 11 (11), 1760 (2022).
  18. Sadeghipour, A., Babaheidarian, P. Making formalin-fixed, paraffin embedded blocks. Methods in Molecular Biology. 1897, 253-268 (2019).
  19. Qin, C., et al. The cutting and floating method for paraffin-embedded tissue for sectioning. Journal of Visualized Experiments. (139), e58288 (2018).
  20. Rekhtman, N., et al. Novel modification of HistoGel-based cell block preparation method: improved sufficiency for molecular studies. Archives of Pathology & Laboratory Medicine. 142 (4), 529-535 (2018).
  21. Shidham, V. B. CellBlockistry: Chemistry and art of cell-block making – A detailed review of various historical options with recent advances. Cytojournal. 16, 12 (2019).
  22. Ali, A., Syed, S. M., Tanwar, P. S. Protocol for in vitro establishment and long-term culture of mouse vaginal organoids. STAR Protocols. 1 (2), 100088 (2020).
  23. Kurihara, I., et al. COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity. PLoS Genet. 3 (6), 102 (2007).
  24. McMaster, M. T., Teng, C. T., Dey, S. K., Andrews, G. K. Lactoferrin in the mouse uterus: analyses of the preimplantation period and regulation by ovarian steroids. Molecular Endocrinology. 6 (1), 101-111 (1992).
  25. Huang, H. L., Chu, S. T., Chen, Y. H. Ovarian steroids regulate 24p3 expression in mouse uterus during the natural estrous cycle and the preimplantation period. The Journal of Endocrinology. 162 (1), 11-19 (1999).
  26. Clevers, H. Modeling development and disease with organoids. Cell. 165 (7), 1586-1597 (2016).
  27. Bigsby, R. M., Cunha, G. R. Estrogen stimulation of deoxyribonucleic acid synthesis in uterine epithelial cells which lack estrogen receptors. Endocrinology. 119 (1), 390-396 (1986).
  28. Clementi, C., et al. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans. PLoS Genetics. 9 (11), 1003863 (2013).
  29. Jeong, J. W., et al. Foxa2 is essential for mouse endometrial gland development and fertility. Biology of Reproduction. 83 (3), 396-403 (2010).
  30. Song, Y., et al. Endometriotic organoids: a novel in vitro model of endometriotic lesion development. bioRxiv. , (2022).
  31. Miyazaki, K., et al. Generation of progesterone-responsive endometrial stromal fibroblasts from human induced pluripotent stem cells: role of the WNT/CTNNB1 pathway. Stem Cell Reports. 11 (5), 1136-1155 (2018).
  32. Yoshimatsu, S., Kisu, I., Qian, E., Noce, T. A new horizon in reproductive research with pluripotent stem cells: successful in vitro gametogenesis in rodents, its application to large animals, and future in vitro reconstitution of reproductive organs such as "Uteroid" and "Oviductoid&#34. 생물학. 11 (7), 987 (2022).
  33. Cheung, V. C., et al. Pluripotent stem cell-derived endometrial stromal fibroblasts in a cyclic, hormone-responsive, coculture model of human decidua. Cell Reports. 35 (7), 109138 (2021).
  34. McGowen, M. R., Erez, O., Romero, R., Wildman, D. E. The evolution of embryo implantation. The International Journal of Development Biology. 58 (2-4), 155-161 (2014).
  35. Carson, D. D., et al. Embryo implantation. 발생학. 223 (2), 217-237 (2000).
  36. Li, Y., Sun, X., Dey, S. K. Entosis allows timely elimination of the luminal epithelial barrier for embryo implantation. Cell Reports. 11 (3), 358-365 (2015).
  37. Jain, V., Chodankar, R. R., Maybin, J. A., Critchley, H. O. D. Uterine bleeding: how understanding endometrial physiology underpins menstrual health. Nature Reviews Endocrinology. 18 (5), 290-308 (2022).
  38. Hayashi, K., et al. Wnt genes in the mouse uterus: potential regulation of implantation. Biology of Reproduction. 80 (5), 989-1000 (2009).
  39. Dunlap, K. A., et al. Postnatal deletion of Wnt7a inhibits uterine gland morphogenesis and compromises adult fertility in mice. Biology of Reproduction. 85 (2), 386-396 (2011).
  40. Ter Steege, E. J., Bakker, E. R. M. The role of R-spondin proteins in cancer biology. Oncogene. 40 (47), 6469-6478 (2021).
  41. Brazil, D. P., Church, R. H., Surae, S., Godson, C., Martin, F. BMP signalling: agony and antagony in the family. Trends in Cell Biology. 25 (5), 249-264 (2015).
  42. Tojo, M., et al. The ALK-5 inhibitor A-83-01 inhibits Smad signaling and epithelial-to-mesenchymal transition by transforming growth factor-beta. Cancer Science. 96 (11), 791-800 (2005).
  43. Zhang, Y., Que, J. BMP signaling in development, stem cells, and diseases of the gastrointestinal tract. Annual Review of Physiology. 82, 251-273 (2020).
  44. Plikus, M. V., et al. Cyclic dermal BMP signalling regulates stem cell activation during hair regeneration. Nature. 451 (7176), 340-344 (2008).
  45. Gurung, S., Werkmeister, J. A., Gargett, C. E. Inhibition of transforming growth factor-β receptor signaling promotes culture expansion of undifferentiated human endometrial mesenchymal stem/stromal cells. Scientific Reports. 5, 15042 (2015).
  46. Lucciola, R., et al. Impact of sustained transforming growth factor-β receptor inhibition on chromatin accessibility and gene expression in cultured human endometrial MSC. Frontiers in Cell and Developmental Biology. 8, 567610 (2020).
  47. Hernandez-Gordillo, V., et al. Fully synthetic matrices for in vitro culture of primary human intestinal enteroids and endometrial organoids. Biomaterials. 254, 120125 (2020).
  48. Gnecco, J. S., et al. Physiomimetic Models of Adenomyosis. Seminars in Reproductive Medicine. 38 (2-03), 179-196 (2020).
  49. Nikolakopoulou, K., Turco, M. Y. Investigation of infertility using endometrial organoids. Reproduction. 161 (5), 113-127 (2021).
  50. Kim, J. J. Preparing for implantation. Elife. 10, 73739 (2021).

Tags

3D Endometrial OrganoidsMouse UterusUterine EpitheliumEnzymatic DissociationMechanical DissociationCell CultureOrganoid EstablishmentCell PelletCollagenaseDNA Solution
check_url/kr/64448?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Tang, S., Parks, S. E., Liao, Z., Cope, D. I., Blutt, S. E., Monsivais, D. Establishing 3D Endometrial Organoids from the Mouse Uterus. J. Vis. Exp. (191), e64448, doi:10.3791/64448 (2023).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image