تحليلات التعبير الجيني في البصيلات البشرية
Summary
هنا ، نصف بروتوكولا يحدد كيفية عزل بصيلات المبيض البشرية عن الأنسجة القشرية المذابة المجمدة لإجراء تحليلات التعبير الجيني.
Abstract
المبيض هو عضو غير متجانس يتكون من أنواع مختلفة من الخلايا. لدراسة الآليات الجزيئية التي تحدث أثناء تكوين الجريب ، يمكن إجراء توطين البروتينات والتعبير الجيني على الأنسجة الثابتة. ومع ذلك ، لتقييم مستويات التعبير الجيني بشكل صحيح في جريب بشري ، يجب عزل هذا الهيكل المعقد والدقيق. ومن ثم ، تم تطوير بروتوكول معدل سبق وصفه من قبل مختبر وودروف لفصل البصيلات (البويضة والخلايا الحبيبية) عن البيئة المحيطة بها. تتم معالجة الأنسجة القشرية المبيضية يدويا أولا للحصول على شظايا صغيرة باستخدام أداتين: قطاعة الأنسجة ومفرمة الأنسجة. ثم يتم هضم الأنسجة إنزيميا مع 0.2 ٪ كولاجيناز و 0.02 ٪ DNase لمدة 40 دقيقة على الأقل. يتم تنفيذ خطوة الهضم هذه عند 37 درجة مئوية و 5٪ CO2 ويرافقها ماصة ميكانيكية للوسط كل 10 دقائق. بعد الحضانة ، يتم جمع البصيلات المعزولة يدويا باستخدام ماصة شعرية دقيقة معايرة تحت تكبير المجهر. إذا كانت البصيلات لا تزال موجودة في قطع الأنسجة ، يتم الانتهاء من الإجراء بالتشريح المجهري اليدوي. يتم جمع البصيلات على الجليد في وسط استزراع ويتم شطفها مرتين في قطرات من محلول ملحي مخزن بالفوسفات. يجب التحكم في عملية الهضم هذه بعناية لتجنب تدهور الجريب. بمجرد أن يبدو أن بنية البصيلات معرضة للخطر أو بعد 90 دقيقة كحد أقصى ، يتم إيقاف التفاعل بمحلول مانع 4 درجات مئوية يحتوي على 10٪ مصل بقري جنيني. يجب جمع ما لا يقل عن 20 جريبا معزولا (بحجم أقل من 75 ميكرومتر) للحصول على كمية كافية من إجمالي الحمض النووي الريبي بعد استخراج الحمض النووي الريبي لتفاعل البلمرة الكمي المتسلسل في الوقت الفعلي (RT-qPCR). بعد الاستخراج ، يصل القياس الكمي للحمض النووي الريبي الكلي من 20 بصيلة إلى قيمة متوسطة تبلغ 5 نانوغرام / ميكرولتر. ثم يتم نسخ الحمض النووي الريبي الكلي إلى cDNA ، ويتم تحليل الجينات ذات الأهمية باستخدام RT-qPCR.
Introduction
المبيض هو عضو معقد يتكون من وحدات وظيفية وهيكلية ، بما في ذلك البصيلات داخل القشرة والسدى. تمت دراسة الجريب ، وهي عملية تنشيط الجريب والنمو والنضج من حالة هادئة بدائية إلى جريب ناضج قادر على الإخصاب ودعم التطور الجنيني المبكر ، على نطاق واسع في البحث1. يمكن أن يؤدي كشف الآليات التي تقود هذه الظاهرة إلى تحسين رعاية الخصوبة للنساء2. تسمح التحليلات على الأنسجة البشرية الثابتة بتقييم التعبير البروتيني وتوطين الجينات داخل الوحدات الوظيفية للمبيض 3,4. ومع ذلك ، هناك حاجة إلى تقنيات محددة لفصل البصيلات عن القشرة المحيطة لتقييم مستويات التعبير الجيني بدقة داخل بصيلات المبيض. ومن ثم ، في دراسة سابقة ، تم تطوير تقنية عزل الجريب للسماح بتحليل التعبير الجيني مباشرة من الوحدة الوظيفية للمبيض5. تم تطوير طرق مختلفة ، مثل الهضم الأنزيمي و / أو العزل الميكانيكي ، بالإضافة إلى التشريح المجهري لالتقاط الليزر ، والذي يسمح بعزل الجريب داخل قطعة من الأنسجة6،7،8،9. يستخدم عزل الجريب على نطاق واسع ، إما مع أنسجة المبيض البشرية أو الحيوانية ، لتقييم ملامح التعبير الجيني للجريبات في جميع مراحل التطور10،11،12. ومع ذلك ، يجب أن يأخذ إجراء العزل الأمثل في الاعتبار البنية الهشة للجريب داخل القشرة الكثيفة ، وبالتالي ، يجب إجراؤه بعناية لتجنب أي ضرر7. تصف هذه المخطوطة إجراء، مقتبسا من بروتوكول وصفه مختبر وودروف، لعزل البصيلات البشرية عن قشرة المبيض المذابة المجمدة من أجل إجراء تحليلات التعبير الجيني13.
الخطوة الأولى لعزل جريب المبيض من الأنسجة البشرية المجمدة هي إجراء الذوبان. يتم تنفيذ هذه العملية بناء على البروتوكول السريري المستخدم لتطعيم أنسجة المبيض المحفوظة بالتبريد ، كما هو موضح سابقا14،15. تهدف العملية إلى إزالة العوامل الواقية من البرودة عن طريق شطف قشرة المبيض بتركيزات متناقصة من الوسط. ثم يتم تفتيت الأنسجة قبل العزل الأنزيمي والميكانيكي لاسترداد البصيلات. يمكن تمييز البصيلات في مراحل مختلفة باستخدام مجهر مجسم ذو تكبير عالي وبصريات عالية الجودة من أجل عزل تلك ذات الأهمية. يتم قياس كل جريب معزول باستخدام مسطرة مدمجة في المجهر ، ويمكن تجميع البصيلات وفقا لمرحلة نموها: بصيلات بدائية (30 ميكرومتر) ، بصيلات أولية (60 ميكرومتر) ، بصيلات ثانوية (120-200 ميكرومتر) ، وجريبات غارية (>200 ميكرومتر) 16. يمكن إجراء مزيد من التصنيف وفقا لمورفولوجيا البصيلات: تحتوي البصيلات البدائية على طبقة واحدة من الخلايا الحبيبية المسطحة (GCs) ، وتحتوي البصيلات الأولية على طبقة واحدة من GCs المكعبة ، وتحتوي البصيلات الثانوية على طبقتين على الأقل من GCs المكعبة ، ووجود تجويف بين GCs يميز المرحلة الغارية. عندما يتم اختيار بصيلات الاهتمام ، يتم إجراء استخراج الحمض النووي الريبي. يتم تقييم كمية وجودة الحمض النووي الريبي قبل تفاعل البوليميراز الكمي المتسلسل في الوقت الفعلي (RT-qPCR) (الشكل 1).
Protocol
Representative Results
Discussion
يعد الحفظ بالتبريد لأنسجة المبيض نهجا واعدا للحفاظ على خصوبة مرضى السرطان. في العيادة ، يتم تطعيم الأنسجة القشرية المذابة مرة أخرى في المريض بعد مغفرة ، مما يسمح باستئناف وظيفة المبيض والخصوبة19,20. إلى جانب الاستخدام السريري ، يمكن أيضا التبرع بشظايا المبيض…
Disclosures
The authors have nothing to disclose.
Acknowledgements
تم دعم هذا العمل من خلال منحة التميز العلمي (EOS) (ID: 30443682). دكتوراه باحثة مشاركة في الصندوق الوطني للبحوث العلمية البلجيكية (FNRS).
Materials
| 2 mm gridded Petri dish | Corning | 430196 | |
| 2100 Bioanalyzer instrument | Agilent | G2939BA | |
| 2100 Expert software | Agilent | version B.02.08.SI648 | |
| 4-wells plate | Sigma Aldrich | D6789 | |
| 6-wells plate | Carl Roth | EKX5.1 | |
| Agilent total RNA 6000 pico kit | Agilent | 5067-1513 | |
| Ascorbic acid | Sigma Aldrich | A4403 | |
| Aspirator tube assemblies for microcapillary pipettes | Sigma Aldrich | A5177 | |
| Centrifuge | Eppendorf | 5424R | |
| Collagenase IV | LifeTechnologies | 17104-019 | |
| DMSO | Sigma Aldrich | D2650 | |
| DNase | Sigma Aldrich | D4527-10kU | |
| FBS | Gibco | 10270-106 | |
| GoScript reverse transcriptase | Promega | A5003 | |
| HSA | CAF DCF | LC4403-41-080 | |
| Leibovitz-15 | LifeTechnologies | 11415-049 | |
| L-Glutamine | Sigma Aldrich | G7513 | |
| McCoy’s 5A + bicarbonate + Hepes | LifeTechnologies | 12330-031 | |
| McIlwain tissue chopper | Stoelting | 51350 | |
| Microcapillary RI EZ-Tips 200 µm | CooperSurgical | 7-72-2200/1 | |
| Microcapillary RI EZ-Tips 75 µm | CooperSurgical | 7-72-2075/1 | |
| NanoDrop 2000/2000c operating software | ThermoFisher | version 1.6 | |
| NanoDrop spectrophotometer | ThermoFisher | 2000/2000c | |
| Penicillin G | Sigma Aldrich | P3032 | |
| PowerTrack SYBR green master mix | ThermoFisher | A46109 | |
| Primers: GDF9 | F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG | ||
| Primers: HPRT | F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA | ||
| Primers: Kit Ligand | F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT | ||
| Real-Time qPCR Quantstudio 3 | ThermoFisher | A33779 | |
| RNAqueous-micro total RNA isolation kit | ThermoFisher | AM1931 | |
| Selenium | Sigma Aldrich | S9133 | |
| Sodium pyruvate | Sigma Aldrich | S8636 | |
| Stereomicroscope | Nikon | SMZ800 | |
| Streptomycine sulfate | Sigma Aldrich | S1277 | |
| Sucrose | Sigma Aldrich | S1888 | |
| Thermo Scientific Forma Series II water-jacketed CO2 incubators | ThermoFisher | 3110 | |
| Thomas Stadie-Riggs tissue slicer | Thomas Scientific | 6727C10 | |
| Transferrin | Roche | 10652202001 |
References
- Gougeon, A. Human ovarian follicular development: From activation of resting follicles to preovulatory maturation. Annales d’Endocrinologie. 71 (3), 132-143 (2010).
- Yang, D. Z., Yang, W., Li, Y., He, Z. Progress in understanding human ovarian folliculogenesis and its implications in assisted reproduction. Journal of Assisted Reproduction and Genetics. 30 (2), 213-219 (2013).
- Rosewell, K. L., Curry, T. E. Detection of ovarian matrix metalloproteinase mRNAs by in situ hybridization. Molecular Endocrinology. 590, 115-129 (2009).
- Tuck, A. R., Robker, R. L., Norman, R. J., Tilley, W. D., Hickey, T. E. Expression and localisation of c-kit and KITL in the adult human ovary. Journal of Ovarian Research. 8, 31 (2015).
- Oktay, K., et al. Isolation and characterization of primordial follicles from fresh and cryopreserved human ovarian tissue. Fertility and Sterility. 67 (3), 481-486 (1997).
- Bonnet, A., et al. Transcriptome profiling of sheep granulosa cells and oocytes during early follicular development obtained by laser capture microdissection. BMC Genomics. 12, 417 (2011).
- Chiti, M. C., et al. A modified and tailored human follicle isolation procedure improves follicle recovery and survival. Journal of Ovarian Research. 10 (1), 71 (2017).
- Kim, E. J., et al. Comparison of follicle isolation methods for mouse ovarian follicle culture in vitro. Reproductive Sciences. 25 (8), 1270-1278 (2018).
- Chen, J., et al. Optimization of follicle isolation for bioengineering of human artificial ovary. Biopreservation and Biobanking. 20 (6), 529-539 (2022).
- Babayev, E., Xu, M., Shea, L. D., Woodruff, T. K., Duncan, F. E. Follicle isolation methods reveal plasticity of granulosa cell steroidogenic capacity during mouse in vitro follicle growth. Molecular Human Reproduction. 28 (10), (2022).
- McDonnell, S. P., Candelaria, J. I., Morton, A. J., Denicol, A. C. Isolation of small preantral follicles from the bovine ovary using a combination of fragmentation, homogenization, and serial filtration. Journal of Visualized Experiments. (187), e64423 (2022).
- Schallmoser, A., Einenkel, R., Färber, C., Sänger, N. In vitro growth (IVG) of human ovarian follicles in frozen thawed ovarian cortex tissue culture supplemented with follicular fluid under hypoxic conditions. Archives of Gynecology and Obstetrics. 306 (4), 1299-1311 (2022).
- Xu, M., et al. In vitro grown human ovarian follicles from cancer patients support oocyte growth. Human Reproduction. 24 (10), 2531-2540 (2009).
- Demeestere, I., Simon, P., Englert, Y., Delbaere, A. Preliminary experience of ovarian tissue cryopreservation procedure: Alternatives, perspectives and feasibility. Reproductive Biomedicine Online. 7 (5), 572-579 (2003).
- Demeestere, I., et al. Ovarian function and spontaneous pregnancy after combined heterotopic and orthotopic cryopreserved ovarian tissue transplantation in a patient previously treated with bone marrow transplantation: Case report. Human Reproduction. 21 (8), 2010-2014 (2006).
- Gougeon, A. Dynamics of follicular growth in the human: A model from preliminary results. Human Reproduction. 1 (2), 81-87 (1986).
- Grosbois, J., Demeestere, I. Dynamics of PI3K and Hippo signaling pathways during in vitro human follicle activation. Human Reproduction. 33 (9), 1705-1714 (2018).
- Grosbois, J., Vermeersch, M., Devos, M., Clarke, H. J., Demeestere, I. Ultrastructure and intercellular contact-mediated communication in cultured human early stage follicles exposed to mTORC1 inhibitor. Molecular Human Reproduction. 25 (11), 706-716 (2019).
- Oktay, K., et al. Endocrine function and oocyte retrieval after autologous transplantation of ovarian cortical strips to the forearm. Journal of the American Medical Association. 286 (12), 1490-1493 (2001).
- Chung, E. H., Lim, S. L., Myers, E., Moss, H. A., Acharya, K. S. Oocyte cryopreservation versus ovarian tissue cryopreservation for adult female oncofertility patients: A cost-effectiveness study. Journal of Assisted Reproduction and Genetics. 38 (9), 2435-2443 (2021).
- Walker, C. A., Bjarkadottir, B. D., Fatum, M., Lane, S., Williams, S. A. Variation in follicle health and development in cultured cryopreserved ovarian cortical tissue: A study of ovarian tissue from patients undergoing fertility preservation. Human Fertility. 24 (3), 188-198 (2021).
- Simon, L. E., Kumar, T. R., Duncan, F. E. In vitro ovarian follicle growth: A comprehensive analysis of key protocol variables. Biology of Reproduction. 103 (3), 455-470 (2020).
- Rice, S., Ojha, K., Mason, H. Human ovarian biopsies as a viable source of pre-antral follicles. Human Reproduction. 23 (3), 600-605 (2008).
- Kristensen, S. G., Rasmussen, A., Byskov, A. G., Andersen, C. Y. Isolation of pre-antral follicles from human ovarian medulla tissue. Human Reproduction. 26 (1), 157-166 (2011).
- Dong, F. -. L., et al. An research on the isolation methods of frozen-thawed human ovarian preantral follicles. International Journal of Clinical and Experimental Medicine. 7 (8), 2298-2303 (2014).
- Lierman, S., et al. Follicles of various maturation stages react differently to enzymatic isolation: a comparison of different isolation protocols. Reproductive Biomedicine Online. 30 (2), 181-190 (2015).
- Abir, R., et al. Pilot study of isolated early human follicles cultured in collagen gels for 24 hours. Human Reproduction. 14 (5), 1299-1301 (1999).
- Abir, R., et al. Morphological study of fully and partially isolated early human follicles. Fertility and Sterility. 75 (1), 141-146 (2001).
- McLaughlin, M., Albertini, D. F., Wallace, W. H. B., Anderson, R. A., Telfer, E. E. Metaphase II oocytes from human unilaminar follicles grown in a multi-step culture system. Molecular Human Reproduction. 24 (3), 135-142 (2018).
- Abir, R., et al. Mechanical isolation and in vitro growth of preantral and small antral human follicles. Fertility and Sterility. 68 (4), 682-688 (1997).
- Vanacker, J., et al. Enzymatic isolation of human primordial and primary ovarian follicles with Liberase DH: Protocol for application in a clinical setting. Fertility and Sterility. 96 (2), 379-383 (2011).
- Amargant, F., et al. Ovarian stiffness increases with age in the mammalian ovary and depends on collagen and hyaluronan matrices. Aging Cell. 19 (11), 13259 (2020).
