Genexpressieanalyses in menselijke follikels
Summary
Hier beschrijven we een protocol dat beschrijft hoe menselijke ovariële follikels kunnen worden geïsoleerd uit bevroren ontdooid corticale weefsel om genexpressieanalyses uit te voeren.
Abstract
De eierstok is een heterogeen orgaan dat bestaat uit verschillende celtypen. Om de moleculaire mechanismen te bestuderen die optreden tijdens folliculogenese, kan de lokalisatie van eiwitten en genexpressie worden uitgevoerd op vast weefsel. Om de genexpressieniveaus in een menselijke follikel goed te kunnen beoordelen, moet deze complexe en delicate structuur echter worden geïsoleerd. Daarom is een aangepast protocol ontwikkeld dat eerder door het laboratorium van Woodruff is beschreven om follikels (de eicel en de granulosacellen) te scheiden van hun omgeving. Het eierstokschorsweefsel wordt eerst handmatig verwerkt om kleine fragmenten te verkrijgen met behulp van twee hulpmiddelen: een weefselsnijder en een weefselhakselaar. Het weefsel wordt vervolgens enzymatisch verteerd met 0,2% collagenase en 0,02% DNase gedurende ten minste 40 minuten. Deze verteringsstap wordt uitgevoerd bij 37 °C en 5% CO2 en gaat gepaard met mechanisch pipetteren van het medium om de 10 min. Na incubatie worden de geïsoleerde follikels handmatig verzameld met behulp van een gekalibreerde microcapillaire pipet onder microscoopvergroting. Als er nog follikels aanwezig zijn in de stukjes weefsel, wordt de procedure voltooid met handmatige microdissectie. De follikels worden verzameld op ijs in een kweekmedium en worden tweemaal gespoeld in druppeltjes fosfaat-gebufferde zoutoplossing. Deze verteringsprocedure moet zorgvuldig worden gecontroleerd om verslechtering van de follikel te voorkomen. Zodra de structuur van de follikels aangetast lijkt te zijn of na maximaal 90 min, wordt de reactie gestopt met een 4 °C blokkerende oplossing die 10% foetaal runderserum bevat. Een minimum van 20 geïsoleerde follikels (kleiner dan 75 μm) moet worden verzameld om een voldoende hoeveelheid totaal RNA te verkrijgen na RNA-extractie voor real-time kwantitatieve polymerasekettingreactie (RT-qPCR). Na extractie bereikt de kwantificering van totaal RNA uit 20 follikels een gemiddelde waarde van 5 ng/μL. Het totale RNA wordt vervolgens achteraf getranscribeerd in cDNA en de genen van belang worden verder geanalyseerd met behulp van RT-qPCR.
Introduction
De eierstok is een complex orgaan dat bestaat uit functionele en structurele eenheden, waaronder de follikels in de cortex en het stroma. Folliculogenese, het proces van follikelactivering, groei en rijping van een primordiale rusttoestand naar een volwassen follikel die kan worden bevrucht en om de vroege embryonale ontwikkeling te ondersteunen, wordt op grote schaal bestudeerd in onderzoek1. Het ontrafelen van de mechanismen die dit fenomeen veroorzaken, zou de vruchtbaarheidszorg voor vrouwenkunnen verbeteren 2. Analyses op vast menselijk weefsel maken de beoordeling van eiwitexpressie en genlokalisatie binnen de functionele eenheden van de eierstokmogelijk 3,4. Er zijn echter specifieke technieken nodig om de follikels te dissociëren van de omliggende cortex om de genexpressieniveaus in de ovariële follikels nauwkeurig te beoordelen. Daarom werd in een eerdere studie een follikelisolatietechniek ontwikkeld om analyses van genexpressie rechtstreeks vanuit de functionele eenheid van de eierstok5 mogelijk te maken. Er zijn verschillende benaderingen ontwikkeld, zoals enzymatische spijsvertering en / of mechanische isolatie, evenals laservangstmicrodissectie, die follikelisolatie in eenstuk weefsel 6,7,8,9 mogelijk maken. Follikelisolatie wordt veel gebruikt, hetzij met menselijk of dierlijk eierstokweefsel, om de genexpressieprofielen van follikels in alle stadia van ontwikkeling te evalueren10,11,12. Een optimale isolatieprocedure moet echter rekening houden met de fragiele structuur van de follikel in de dichte cortex en moet daarom met zorg worden uitgevoerd om schade te voorkomen7. Dit manuscript beschrijft een procedure, aangepast van een protocol beschreven door Woodruff’s laboratorium, om menselijke follikels te isoleren uit bevroren ontdooide ovariële cortex om genexpressieanalyses uit te voeren13.
De eerste stap van ovariële follikelisolatie van bevroren menselijk weefsel is de ontdooiingsprocedure. Dit proces wordt uitgevoerd op basis van het klinische protocol dat wordt gebruikt voor het enten van gecryopreserveerd ovariumweefsel, zoals eerder beschreven14,15. Het proces is gericht op het verwijderen van de cryoprotectieve middelen door de ovariële cortex te spoelen in afnemende concentraties van het medium. Vervolgens wordt het weefsel gefragmenteerd voordat enzymatische en mechanische isolatie plaatsvindt om de follikels op te halen. Follikels in verschillende stadia kunnen worden onderscheiden met behulp van een stereomicroscoop met hoge vergroting en optica van goede kwaliteit om de interessante te isoleren. Elke geïsoleerde follikel wordt gemeten met behulp van een liniaal geïntegreerd in de microscoop, en de follikels kunnen worden samengevoegd volgens hun ontwikkelingsstadium: primordiale follikels (30 μm), primaire follikels (60 μm), secundaire follikels (120-200 μm) en antrale follikels (>200 μm)16. Verdere classificatie kan worden uitgevoerd volgens de morfologie van de follikels: primordiale follikels hebben één laag afgeplatte granulosacellen (GC’s), primaire follikels hebben één laag kubusvormige GC’s, secundaire follikels hebben ten minste twee lagen kuboïdale GC’s en de aanwezigheid van een holte tussen de GC’s kenmerkt het antrale stadium. Wanneer follikels van belang worden geselecteerd, wordt RNA-extractie uitgevoerd. De hoeveelheid en kwaliteit van RNA worden geëvalueerd voorafgaand aan de real-time kwantitatieve polymerasekettingreactie (RT-qPCR) (figuur 1).
Protocol
Representative Results
Discussion
De cryopreservatie van eierstokweefsel is een veelbelovende aanpak voor het behoud van de vruchtbaarheid van kankerpatiënten. In de kliniek wordt ontdooid corticale weefsel na remissie terug in de patiënt geënt, waardoor de ovariële functie en vruchtbaarheid kunnen worden hervat19,20. Naast klinisch gebruik kunnen resterende ovariumfragmenten ook worden gedoneerd voor onderzoek aan het einde van de opslagperiode om de mechanismen te bestuderen die folliculoge…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd ondersteund door een Excellence of Science (EOS) beurs (ID: 30443682). I.D. is associate researcher bij het Fonds National de la Recherche Scientifique de Belgique (FNRS).
Materials
| 2 mm gridded Petri dish | Corning | 430196 | |
| 2100 Bioanalyzer instrument | Agilent | G2939BA | |
| 2100 Expert software | Agilent | version B.02.08.SI648 | |
| 4-wells plate | Sigma Aldrich | D6789 | |
| 6-wells plate | Carl Roth | EKX5.1 | |
| Agilent total RNA 6000 pico kit | Agilent | 5067-1513 | |
| Ascorbic acid | Sigma Aldrich | A4403 | |
| Aspirator tube assemblies for microcapillary pipettes | Sigma Aldrich | A5177 | |
| Centrifuge | Eppendorf | 5424R | |
| Collagenase IV | LifeTechnologies | 17104-019 | |
| DMSO | Sigma Aldrich | D2650 | |
| DNase | Sigma Aldrich | D4527-10kU | |
| FBS | Gibco | 10270-106 | |
| GoScript reverse transcriptase | Promega | A5003 | |
| HSA | CAF DCF | LC4403-41-080 | |
| Leibovitz-15 | LifeTechnologies | 11415-049 | |
| L-Glutamine | Sigma Aldrich | G7513 | |
| McCoy’s 5A + bicarbonate + Hepes | LifeTechnologies | 12330-031 | |
| McIlwain tissue chopper | Stoelting | 51350 | |
| Microcapillary RI EZ-Tips 200 µm | CooperSurgical | 7-72-2200/1 | |
| Microcapillary RI EZ-Tips 75 µm | CooperSurgical | 7-72-2075/1 | |
| NanoDrop 2000/2000c operating software | ThermoFisher | version 1.6 | |
| NanoDrop spectrophotometer | ThermoFisher | 2000/2000c | |
| Penicillin G | Sigma Aldrich | P3032 | |
| PowerTrack SYBR green master mix | ThermoFisher | A46109 | |
| Primers: GDF9 | F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG | ||
| Primers: HPRT | F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA | ||
| Primers: Kit Ligand | F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT | ||
| Real-Time qPCR Quantstudio 3 | ThermoFisher | A33779 | |
| RNAqueous-micro total RNA isolation kit | ThermoFisher | AM1931 | |
| Selenium | Sigma Aldrich | S9133 | |
| Sodium pyruvate | Sigma Aldrich | S8636 | |
| Stereomicroscope | Nikon | SMZ800 | |
| Streptomycine sulfate | Sigma Aldrich | S1277 | |
| Sucrose | Sigma Aldrich | S1888 | |
| Thermo Scientific Forma Series II water-jacketed CO2 incubators | ThermoFisher | 3110 | |
| Thomas Stadie-Riggs tissue slicer | Thomas Scientific | 6727C10 | |
| Transferrin | Roche | 10652202001 |
References
- Gougeon, A. Human ovarian follicular development: From activation of resting follicles to preovulatory maturation. Annales d’Endocrinologie. 71 (3), 132-143 (2010).
- Yang, D. Z., Yang, W., Li, Y., He, Z. Progress in understanding human ovarian folliculogenesis and its implications in assisted reproduction. Journal of Assisted Reproduction and Genetics. 30 (2), 213-219 (2013).
- Rosewell, K. L., Curry, T. E. Detection of ovarian matrix metalloproteinase mRNAs by in situ hybridization. Molecular Endocrinology. 590, 115-129 (2009).
- Tuck, A. R., Robker, R. L., Norman, R. J., Tilley, W. D., Hickey, T. E. Expression and localisation of c-kit and KITL in the adult human ovary. Journal of Ovarian Research. 8, 31 (2015).
- Oktay, K., et al. Isolation and characterization of primordial follicles from fresh and cryopreserved human ovarian tissue. Fertility and Sterility. 67 (3), 481-486 (1997).
- Bonnet, A., et al. Transcriptome profiling of sheep granulosa cells and oocytes during early follicular development obtained by laser capture microdissection. BMC Genomics. 12, 417 (2011).
- Chiti, M. C., et al. A modified and tailored human follicle isolation procedure improves follicle recovery and survival. Journal of Ovarian Research. 10 (1), 71 (2017).
- Kim, E. J., et al. Comparison of follicle isolation methods for mouse ovarian follicle culture in vitro. Reproductive Sciences. 25 (8), 1270-1278 (2018).
- Chen, J., et al. Optimization of follicle isolation for bioengineering of human artificial ovary. Biopreservation and Biobanking. 20 (6), 529-539 (2022).
- Babayev, E., Xu, M., Shea, L. D., Woodruff, T. K., Duncan, F. E. Follicle isolation methods reveal plasticity of granulosa cell steroidogenic capacity during mouse in vitro follicle growth. Molecular Human Reproduction. 28 (10), (2022).
- McDonnell, S. P., Candelaria, J. I., Morton, A. J., Denicol, A. C. Isolation of small preantral follicles from the bovine ovary using a combination of fragmentation, homogenization, and serial filtration. Journal of Visualized Experiments. (187), e64423 (2022).
- Schallmoser, A., Einenkel, R., Färber, C., Sänger, N. In vitro growth (IVG) of human ovarian follicles in frozen thawed ovarian cortex tissue culture supplemented with follicular fluid under hypoxic conditions. Archives of Gynecology and Obstetrics. 306 (4), 1299-1311 (2022).
- Xu, M., et al. In vitro grown human ovarian follicles from cancer patients support oocyte growth. Human Reproduction. 24 (10), 2531-2540 (2009).
- Demeestere, I., Simon, P., Englert, Y., Delbaere, A. Preliminary experience of ovarian tissue cryopreservation procedure: Alternatives, perspectives and feasibility. Reproductive Biomedicine Online. 7 (5), 572-579 (2003).
- Demeestere, I., et al. Ovarian function and spontaneous pregnancy after combined heterotopic and orthotopic cryopreserved ovarian tissue transplantation in a patient previously treated with bone marrow transplantation: Case report. Human Reproduction. 21 (8), 2010-2014 (2006).
- Gougeon, A. Dynamics of follicular growth in the human: A model from preliminary results. Human Reproduction. 1 (2), 81-87 (1986).
- Grosbois, J., Demeestere, I. Dynamics of PI3K and Hippo signaling pathways during in vitro human follicle activation. Human Reproduction. 33 (9), 1705-1714 (2018).
- Grosbois, J., Vermeersch, M., Devos, M., Clarke, H. J., Demeestere, I. Ultrastructure and intercellular contact-mediated communication in cultured human early stage follicles exposed to mTORC1 inhibitor. Molecular Human Reproduction. 25 (11), 706-716 (2019).
- Oktay, K., et al. Endocrine function and oocyte retrieval after autologous transplantation of ovarian cortical strips to the forearm. Journal of the American Medical Association. 286 (12), 1490-1493 (2001).
- Chung, E. H., Lim, S. L., Myers, E., Moss, H. A., Acharya, K. S. Oocyte cryopreservation versus ovarian tissue cryopreservation for adult female oncofertility patients: A cost-effectiveness study. Journal of Assisted Reproduction and Genetics. 38 (9), 2435-2443 (2021).
- Walker, C. A., Bjarkadottir, B. D., Fatum, M., Lane, S., Williams, S. A. Variation in follicle health and development in cultured cryopreserved ovarian cortical tissue: A study of ovarian tissue from patients undergoing fertility preservation. Human Fertility. 24 (3), 188-198 (2021).
- Simon, L. E., Kumar, T. R., Duncan, F. E. In vitro ovarian follicle growth: A comprehensive analysis of key protocol variables. Biology of Reproduction. 103 (3), 455-470 (2020).
- Rice, S., Ojha, K., Mason, H. Human ovarian biopsies as a viable source of pre-antral follicles. Human Reproduction. 23 (3), 600-605 (2008).
- Kristensen, S. G., Rasmussen, A., Byskov, A. G., Andersen, C. Y. Isolation of pre-antral follicles from human ovarian medulla tissue. Human Reproduction. 26 (1), 157-166 (2011).
- Dong, F. -. L., et al. An research on the isolation methods of frozen-thawed human ovarian preantral follicles. International Journal of Clinical and Experimental Medicine. 7 (8), 2298-2303 (2014).
- Lierman, S., et al. Follicles of various maturation stages react differently to enzymatic isolation: a comparison of different isolation protocols. Reproductive Biomedicine Online. 30 (2), 181-190 (2015).
- Abir, R., et al. Pilot study of isolated early human follicles cultured in collagen gels for 24 hours. Human Reproduction. 14 (5), 1299-1301 (1999).
- Abir, R., et al. Morphological study of fully and partially isolated early human follicles. Fertility and Sterility. 75 (1), 141-146 (2001).
- McLaughlin, M., Albertini, D. F., Wallace, W. H. B., Anderson, R. A., Telfer, E. E. Metaphase II oocytes from human unilaminar follicles grown in a multi-step culture system. Molecular Human Reproduction. 24 (3), 135-142 (2018).
- Abir, R., et al. Mechanical isolation and in vitro growth of preantral and small antral human follicles. Fertility and Sterility. 68 (4), 682-688 (1997).
- Vanacker, J., et al. Enzymatic isolation of human primordial and primary ovarian follicles with Liberase DH: Protocol for application in a clinical setting. Fertility and Sterility. 96 (2), 379-383 (2011).
- Amargant, F., et al. Ovarian stiffness increases with age in the mammalian ovary and depends on collagen and hyaluronan matrices. Aging Cell. 19 (11), 13259 (2020).
