الحقن المجهري للفيروس القهقري RCAS (A) المؤتلف في عدسة الدجاج الجنينية
Summary
تصف ورقة البروتوكول هذه منهجية الحقن المجهري لعدسة الدجاج الجنينية لفيروس RCAS (A) كأداة لدراسة الوظيفة في الموقع والتعبير عن البروتينات أثناء نمو العدسة.
Abstract
الدجاج الجنيني (Gallus domesticus) هو نموذج حيواني راسخ لدراسة تطور العدسة وعلم وظائف الأعضاء ، نظرا لدرجة تشابهها العالية مع العدسة البشرية. RCAS (A) هو فيروس ارتجاعي دجاج مؤهل للتكاثر يصيب الخلايا المنقسمة ، والذي يعمل كأداة قوية لدراسة التعبير في الموقع ووظيفة البروتينات البرية والطافرة أثناء تطوير العدسة عن طريق الحقن المجهري في التجويف الفارغ لحويصلة العدسة في مراحل النمو المبكرة ، مما يقصر عمله على خلايا العدسة المتكاثرة المحيطة. بالمقارنة مع الأساليب الأخرى ، مثل النماذج المعدلة وراثيا والثقافات خارج الجسم الحي ، فإن استخدام الفيروس القهقري للطيور RCAS (A) المختص بالتكرار يوفر نظاما فعالا للغاية وسريعا وقابلا للتخصيص للتعبير عن البروتينات الخارجية في أجنة الصيصان. على وجه التحديد ، يمكن أن يقتصر نقل الجينات المستهدف على خلايا ألياف العدسة التكاثرية دون الحاجة إلى محفزات خاصة بالأنسجة. في هذه المقالة ، سنلقي نظرة عامة موجزة على الخطوات اللازمة لإعداد RCAS (A) للفيروس القهقري المؤتلف ، ونقدم نظرة عامة مفصلة وشاملة على إجراء الحقن المجهري ، ونقدم نتائج عينة من التقنية.
Introduction
الهدف من هذا البروتوكول هو وصف منهجية الحقن المجهري لعدسة الدجاج الجنينية ل RCAS (A) (ساركوما الطيور / الفيروس القهقري A المختص بالتكرار). لقد ثبت أن التوصيل الفعال للفيروسات القهقرية في عدسة الدجاج الجنينية أداة واعدة للدراسة في الجسم الحي للآلية الجزيئية ووظيفة بنية بروتينات العدسة في فسيولوجيا العدسة الطبيعية والحالات المرضية والتطور. علاوة على ذلك ، يمكن استخدام هذا النموذج التجريبي لتحديد الأهداف العلاجية وفحص الأدوية لحالات مثل إعتام عدسة العين الخلقي البشري. إجمالا ، يهدف هذا البروتوكول إلى وضع الخطوات اللازمة لتطوير منصة قابلة للتخصيص لدراسة بروتينات العدسة.
الكتاكيت الجنينية (Gallus domesticus) ، بسبب تشابهها في بنية العدسة ووظيفتها مع العدسة البشرية ، هي نموذج حيواني راسخ لدراسة تطور العدسة وعلم وظائف الأعضاء1،2،3،4. يعتبر استخدام الفيروس القهقري للطيور RCAS (A) المختص بالتكرار نظاما فعالا للغاية وسريعا وقابلا للتخصيص للتعبير عن البروتينات الخارجية في أجنة الصيصان. والجدير بالذكر أن لديها قدرة فريدة على حصر نقل الجينات المستهدفة في خلايا ألياف العدسة التكاثرية دون الحاجة إلى محفزات خاصة بالأنسجة ، باستخدام الإطار الزمني الفريد للتطور الجنيني الذي يسمح فيه وجود تجويف العدسة الفارغ بالحقن المجهري RCAS (A) في الموقع المقيد للتعبير عن البروتينات الخارجية داخل خلايا ألياف العدسة التكاثرية5 ، 6,7,8.
يعتمد إجراء الحقن المجهري لجنين الفرخ ، الموصوف بعمق هنا ، جزئيا في الأصل على عمل Fekete et. al.6 وتطويرها كذلك من قبل جيانغ وآخرون. AL.8 وقد تم استخدامه كوسيلة لإدخال كل من البلازميدات الفيروسية وغير الفيروسية في عدسة الكتاكيت الجنينية1،9،10،11،12،13. بشكل عام ، يوضح العمل السابق إمكانية استخدام هذه المنهجية لدراسة تطور العدسة ، والتمايز ، والاتصال الخلوي ، وتطور المرض ، واكتشاف واختبار الأهداف العلاجية للحالات المرضية للعدسة مثل إعتام عدسة العين.
Protocol
Representative Results
Discussion
يوفر هذا النموذج التجريبي الفرصة للتعبير عن البروتين (البروتينات) ذات الأهمية في العدسة السليمة مما يؤدي إلى دراسة الأهمية الوظيفية لهذه البروتينات في بنية العدسة ووظيفتها. يعتمد نموذج الحقن المجهري للفرخ الجنيني جزئيا على عمل Fekete et. al.6 وتم تطويره بواسطة Jiang et. al.8</sup…
Disclosures
The authors have nothing to disclose.
Acknowledgements
تم دعم هذا العمل من خلال منح المعاهد الوطنية للصحة (NIH): RO1 EY012085 (إلى JXJ) و F32DK134051 (إلى F.M.A) ، ومنحة مؤسسة ويلش: AQ-1507 (إلى JXJ). المحتوى هو مسؤولية المؤلفين وحدهم ولا يمثل بالضرورة الآراء الرسمية للمعاهد الوطنية للصحة. تم إنشاء الأرقام جزئيا باستخدام Biorender.com.
Materials
| 0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
| 35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
| Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
| Constructs | GENEWIZ | – | For generation of constructs |
| Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
| DNA PCR primers | Integrated DNA Technologies | – | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
| Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
| Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
| Egg Holder | – | – | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
| Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
| Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
| Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
| Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
| Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
| Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
| Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
| Lipofectamine | Invitrogen | L3000001 | For transfection |
| Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
| Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
| Microscope | Keyence | BZ-X710 | For imaging staining |
| Parafilm | FisherScientific | 03-448-254 | Placing solution |
| Penicillin/Streptomycin | Invitrogen | For cell culture | |
| Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
| rabbit anti-chick AQP0 | Self generated | – | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
| rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
| Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
| Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
References
- Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. Development of a potent embryonic chick lens model for studying congenital cataracts in vivo. Communications Biology. 4 (1), 325 (2021).
- Chen, Y., et al. γ-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds. The FEBS Journal. 283 (8), 1516-1530 (2016).
- Coulombre, A. J., Coulombre, J. L. Lens development. I. Role of the lens in eye growth. Journal of Experimental Zoology. 156 (1), 39-47 (1964).
- McKeehan, M. S. Induction of portions of the chick lens without contact with the optic cup. The Anatomical Record. 132 (3), 297-305 (1958).
- Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo. Molecular immunology. 47 (7-8), 1619-1628 (2010).
- Fekete, D. M., Cepko, C. L. Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo. Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).
- Jiang, J. X. Use of retroviruses to express connexins. Methods in Molecular Biology. , 159-174 (2001).
- Jiang, J. X., Goodenough, D. A. Retroviral expression of connexins in embryonic chick lens. Investigative Ophthalmology & Visual Science. 39 (3), 537-543 (1998).
- Shestopalov, V. I., Bassnett, S. Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core. Journal of Cell Science. 113 (11), 1913-1921 (2000).
- Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50. Journal of Cell Science. 124 (2), 198-206 (2011).
- Li, Z., et al. The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression. Journal of Biological Chemistry. 299 (3), 102965 (2023).
- Shestopalov, V. I., Bassnett, S. Exogenous gene expression and protein targeting in lens fiber cells. Investigative Ophthalmology & Visual Science. 40 (7), 1435-1443 (1999).
- Shestopalov, V. I., Bassnett, S. Three-dimensional organization of primary lens fiber cells. Investigative Ophthalmology & Visual Science. 41 (3), 859-863 (2000).
- Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. Journal of Virology. 61 (10), 3004-3012 (1987).
- Yan, R. T., Wang, S. Z. Production of high-titer RCAS retrovirus. Methods in Molecular Biology. 884, 193-199 (2012).
- Kingston, R. E. Introduction of DNA into mammalian cells. Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).
- Li, Y., et al. Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model. STAR Protocols. 3 (1), 101060 (2022).
- Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Developmental Dynamics. 195 (4), 231-272 (1992).
- Hallagan, J. B., Allen, D. C., Borzelleca, J. F. The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification. Food and Chemical Toxicology. 33 (6), 515-528 (1995).
- Okada, T. S., Eguchi, G., Takeichi, M. The expression of differentiation by chicken lens epithelium in in vitro cell culture. Development, Growth & Differentiation. 13 (4), 323-336 (1971).
- Menko, A. S., Klukas, K. A., Johnson, R. G. Chicken embryo lens cultures mimic differentiation in the lens. 발생학. 103 (1), 129-141 (1984).
- Parreno, J., et al. Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells. Frontiers in Cell and Developmental Biology. 10, 983178 (2022).
- Edwards, A., Gupta, J. D., Harley, J. D. Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens. Experimental Eye Research. 15 (4), 495-498 (1973).
- Musil, L. S. Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation. Journal of Membrane Biology. 245 (7), 357-368 (2012).
- West-Mays, J. A., Pino, G., Lovicu, F. J. Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis. Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).
- Upreti, A., et al. Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response. Cells. 12 (3), 501 (2023).
- Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. Activation of SRC kinases signals induction of posterior capsule opacification. Investigative Ophthalmology & Visual Science. 48 (5), 2214-2223 (2007).
- Briskin, M. J., et al. Heritable retroviral transgenes are highly expressed in chickens. Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).
- Hughes, S. H. The RCAS vector system. Folia Biologica. 50 (3-4), 107-119 (2004).
