High-Resolution Melting PCR to Determine Sequence Variations in Mutant DNA Sequences
Published: May 31, 2023
Abstract
Source: Kisserli, A., et al. High-resolution Melting PCR for Complement Receptor 1 Length Polymorphism Genotyping: An Innovative Tool for Alzheimer's Disease Gene Susceptibility Assessment. J. Vis. Exp. (2017).
In this video, we describe a high-resolution melting PCR technique to determine the length polymorphism of DNA fragments of varying sequence lengths, based on melting temperature analysis.
Protocol
1. HRM-PCR Protocol Thaw the DNA samples. Dilute the DNA samples in 1.5 mL tubes with water to adjust them to a concentration of 10 ng/µL NOTE: The total volume of diluted DNA should be between 2 µL and 10 µL. Thaw the primer solutions. Dilute the primer solutions in 1.5-mL tubes with water to adjust them to the same concentration of 6 µM. NOTE: The primer sequences and reaction conditions are provided in Table 1.</…
Representative Results
Figure 1: Screenshots of the graphical interface of the software used in step 2 of the protocol. (A) Open the gene scanning software. (B) Amplification program and melting curve program. (C) Click on Sample editor in the Module bar. (D) Select Scanning. (E) Define the properties of the samples. …
Declarações
The authors have nothing to disclose.
Materials
| Lab coat | protection | ||
| SensiCareIce powder-free Nitrile Exam gloves | Medline Industries, Inc, Mundelein, IL 60060, USA | 486802 | sample protection |
| Eppendorf Reference 2 pipette, 0.5-10µL | Eppendorf France SAS, F-78360 Montesson, France | 4920000024 | sample pipetting |
| Eppendorf Reference 2 pipette, 20-100µL | Eppendorf France SAS, F-78360 Montesson, France | 4920000059 | sample pipetting |
| Eppendorf Reference 2 pipette, 100-1000µL | Eppendorf France SAS, F-78360 Montesson, France | 4920000083 | sample pipetting |
| TipOne 10µL Graduated, filter tip | Starlab GmbH, D-22926 Ahrenburg, Germany | S1121-3810 | sample pipetting |
| TipOne 1-100µL bevelled, filter tip | Starlab GmbH, D-22926 Ahrenburg, Germany | S1120-1840 | sample pipetting |
| ART 1000E Barrier Tip | Thermo Fischer Scientific , F-67403 Illkirch, France | 2079E | sample pipetting |
| Eppendorf Safe-Lock Tubes, 1.5 mL, Eppendorf Quality | Eppendorf France SAS, F-78360 Montesson, France | 30120086 | mix |
| Vortex-Genie 2 | Scientific Industries, Inc, Bohemia, NY 111716, USA | SI-0236 | mix |
| Mikro 200 centrifuge | Hettich Zentrifugen, D-78532, Germany | 0002020-02-00 | centrifugation |
| Multipette E3 | Eppendorf France SAS, F-78360 Montesson, France | 4987000010 | distribution |
| Light Cycler 480 multiwell plate 96, white | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 4729692001 | reaction place |
| Light Cycler 480 sealing foil | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 4429757001 | coverage |
| LightCycler 480 Instrument II, 96-well | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 05015278001 | high resolution melting polymerase chain reaction |
| Heraeus Megafuge 11R centrifuge | Thermo Fischer Scientific , F-67403 Illkirch, France | 75004412 | centrifugation |
| LightCycler 480 High Resolution Melting Master | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 04909631001 | reaction reagents |
| CN3 primer: 5'ggccttagacttctcctgc 3' | Eurogentec Biologics Division, B4102 Seraing, Belgium | reaction reagent | |
| CN3re primer: 5'gttgacaaattggcggcttcg 3' | Eurogentec Biologics Division, B4102 Seraing, Belgium | reaction reagents | |
| light cycler 480 SW 1.5.1 software | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | software used for HRM-PCR CR1 polymorphism data analysis |
Tags
Citar este artigo
High-Resolution Melting PCR to Determine Sequence Variations in Mutant DNA Sequences. J. Vis. Exp. (Pending Publication), e21360, doi: (2023).