High-Resolution Melting PCR to Determine Sequence Variations in Mutant DNA Sequences

Abstract

Source: Kisserli, A., et al. High-resolution Melting PCR for Complement Receptor 1 Length Polymorphism Genotyping: An Innovative Tool for Alzheimer's Disease Gene Susceptibility Assessment. J. Vis. Exp. (2017).

In this video, we describe a high-resolution melting PCR technique to determine the length polymorphism of DNA fragments of varying sequence lengths, based on melting temperature analysis.

Protocol

1. HRM-PCR Protocol

1. Thaw the DNA samples. Dilute the DNA samples in 1.5 mL tubes with water to adjust them to a concentration of 10 ng/µL
   NOTE: The total volume of diluted DNA should be between 2 µL and 10 µL.
2. Thaw the primer solutions. Dilute the primer solutions in 1.5-mL tubes with water to adjust them to the same concentration of 6 µM.
   NOTE: The primer sequences and reaction conditions are provided in Table 1.
3. Thaw the HRM-PCR kit solutions and mix carefully by vortexing to ensure the recovery of all contents. Briefly spin the three vials containing....

Results

Figure 1: Screenshots of the graphical interface of the software used in step 2 of the protocol. (A) Open the gene scanning software. (B) Amplification program and melting curve program. (C) Click on Sample edit.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Lab coat			protection
SensiCareIce powder-free Nitrile Exam gloves	Medline Industries, Inc, Mundelein, IL 60060, USA	486802	sample protection
Eppendorf Reference 2 pipette, 0.5-10µL	Eppendorf France SAS, F-78360 Montesson, France	4920000024	sample pipetting
Eppendorf Reference 2 pipette, 20-100µL	Eppendorf France SAS, F-78360 Montesson, France	4920000059	sample pipetting
Eppendorf Reference 2 pipette, 100-1000µL	Eppendorf France SAS, F-78360 Montesson, France	4920000083	sample pipetting
TipOne 10µL Graduated, filter tip	Starlab GmbH, D-22926 Ahrenburg, Germany	S1121-3810	sample pipetting
TipOne 1-100µL bevelled, filter tip 	Starlab GmbH, D-22926 Ahrenburg, Germany	S1120-1840	sample pipetting
ART 1000E Barrier Tip	Thermo Fischer Scientific , F-67403 Illkirch, France	2079E	sample pipetting
Eppendorf Safe-Lock Tubes, 1.5 mL, Eppendorf Quality	Eppendorf France SAS, F-78360 Montesson, France	30120086	mix
Vortex-Genie 2	Scientific Industries, Inc, Bohemia, NY 111716, USA	SI-0236	mix
Mikro 200 centrifuge	Hettich Zentrifugen, D-78532, Germany	0002020-02-00	centrifugation
Multipette E3	Eppendorf France SAS, F-78360 Montesson, France	4987000010	distribution
Light Cycler 480 multiwell plate 96, white	Roche Diagnostics GmbH, D-68305 Mannheim, Germany	4729692001	reaction place
Light Cycler 480 sealing foil	Roche Diagnostics GmbH, D-68305 Mannheim, Germany	4429757001	coverage
LightCycler 480 Instrument II, 96-well	Roche Diagnostics GmbH, D-68305 Mannheim, Germany	05015278001	high resolution melting polymerase chain reaction
Heraeus Megafuge 11R centrifuge	Thermo Fischer Scientific , F-67403 Illkirch, France	75004412	centrifugation
LightCycler 480 High Resolution Melting Master	Roche Diagnostics GmbH, D-68305 Mannheim, Germany	04909631001	reaction reagents
CN3 primer: 5'ggccttagacttctcctgc 3'	Eurogentec Biologics Division, B4102 Seraing, Belgium		reaction reagent
CN3re primer: 5'gttgacaaattggcggcttcg 3'	Eurogentec Biologics Division, B4102 Seraing, Belgium		reaction reagents
light cycler 480 SW 1.5.1 software	Roche Diagnostics GmbH, D-68305 Mannheim, Germany		software used for HRM-PCR CR1 polymorphism data analysis