에 박테리아 기능 네트워크 및 경로를 매핑<em> 대장균</em> 합성 유전자 배열을 사용하여
Summary
체계적인 대규모 합성 유전자 (유전자 유전자 또는 epistasis) 상호 작용 화면은 유전 이중화 및 경로 간 대화를 탐험하는 데 사용할 수 있습니다. 여기, 우리는 높은 처리량 정량 합성 유전자 배열 검사 기술을 설명, eSGA 우리는 epistatic 관계를 elucidating과의 유전 적 상호 작용 네트워크를 탐험하기 위해 개발이 칭했다<em> 대장균</em>.
Abstract
Phenotypes는 물리적 (단백질 단백질 등) 및 기능 (예 : 유전자 – 유전자 또는 유전자)의 상호 작용 (GI) 1의 복잡한 일련의에 의해 결정됩니다. 물리적 상호 작용은 세균의 단백질은 단지로 등록 된 표시 할 수 있지만, 반드시 경로 수준의 기능 relationships1를 공개하지 않습니다. 이 삭제되거나 inactivated 유전자를 베어링 더블 돌연변이의 성장을 측정하고 해당 단일 돌연변이에 비해되어있는 GI 화면, loci 사이 epistatic 종속성을 조명하고 따라서 새로운 기능의 관계 2 검색하고 발견 할 수있는 수단을 제공 할 수 있습니다. 대형 GI지도는 효모 3-7과 같은 진핵 생물에 대해보고 있지만, GI 정보는 박테리아 genomes의 기능 주석을 방해 prokaryotes 8에 대한 희박한 유지되었습니다. 이를 위해, 우리와 다른 사람들은 높은 처리량 정량 세균 GI 검사 방법 9, 10을 개발했습니다 </>를 논의하게 될 것입니다.
여기, 우리는 양적 E.를 수행하는 데 필요한 주요 단계를 제시 체계적으로 생성하고 식민지 배열 형식의 이중 돌연변이 다수의 피트니스을 측정하기 위해 자연 박테리아 활용과 상동 재조합을 사용하여 대장균 게놈 규모의 9 합성 유전자 배열 (eSGA) 심사 절차. 간단히, 로봇이 전송하는 데 사용됩니다 , 활용을 통해 chloramphenicol (CM)는 – 마크 F-받는 종자 – 엔지니어링 Hfr에서 돌연변이 대립 유전자 (재조합 높은 주파수) kanamycin의 정렬 배열 (관)에 '기증자 변종'을 표시했습니다. 일반적으로, 우리는에 손실 기능을 중요하지 않은 유전자 삭제를 베어링 단일 돌연변이 ( '케이'컬렉션 11 예)와 필수 유전자 hypomorphic 변이를 (감소 단백질 표현, 안정성, 또는 활동 9, 12, 13를 부여 즉 대립 유전자)를 사용 중요하지 않은, 필수 유전자, 고해상도의 기능 연관을 쿼리pectively. 상동 재조합에 의해 활용하고 다음의 유전자 교환 인한 후, 결과를 두 번 돌연변이는 모두 항생제를 포함하는 고체 매체에 선택됩니다. 가지 후, 플레이트는 디지털 이미징하고 식민지 크기는 양적 내부 자동 이미지 처리 시스템 14를 사용하여 채점하고 있습니다. GIS는 이중 돌연변이의 성장 속도가 예상보다 9 중 훨씬 더 나은 또는 더 나쁜 경우 공개됩니다. 악화 (또는 부정적) GIS는 종종 같은 필수 과정 2 가해진 보상 경로에서 유전자 쌍의 손실 기능 돌연변이 사이에 발생. 여기 하나의 유전자의 손실은 단일 돌연변이가 가능한이 같은 것을 버퍼입니다. 그러나 두 경로의 손실이 해로운이며, 합성 lethality 또는 질병 (즉, 느린 성장)에 발생합니다. 반대로, 경감 (또는 긍정적) 상호 작용과 같은 경로 나 복잡한 단백질 2 유전자 사이에 발생할 수 있습니다혼자 두 유전자의 삭제는 종종 경로 또는 추가 섭동 더, 따라서 성장을 활동을 줄이고하지 않는 등 단지의 정상적인 기능을 교란하기에 충분합니다. 전반적으로, 체계적으로 파악하고 GI 네트워크를 분석하는 것은 다른 방법으로 놓친 경로 수준의 정보가 9 유추 할 수있는 유전자, 많은 수의 사이의 기능적 관계의 편견, 글로벌지도를 제공 할 수 있습니다.
Protocol
1. Recombineering 15, 16 Hfr 카발리 기증 돌연변이 변종을 구축 eSGA 기증자의 얼룩를 만들기위한 단계는 아래에 설명되어 있습니다. 간단히, 우리는 대상 λ를 사용하여 – 빨간색은 중요하지 않은 유전자 삭제 뮤턴트 (섹션 1.1) 또는 다음으로 사용됩니다 필수적인 유전자 hypomorphic 돌연변이 기증 변종 (1.2 항)을 만들 PCR에 의해 생성 된 증폭 선택 DNA 마커 카세트의 …
Representative Results
GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio…
Discussion
우리는 GI을 조사하여 경로 수준에서 박테리아 유전자 기능을 조사하기 위해 로봇 eSGA 검사를 사용하기위한 단계 – 현명한 프로토콜을 설명하고 있습니다. 이 접근 방식은 E.에서 개별 유전자뿐만 아니라 전체 생물 시스템을 연구하는 데 사용할 수 있습니다 대장균. 조심스럽게 모든 적절한 컨트롤을 포함 위에서 설명한 실험 단계를 실행하고, 엄격하게 분석하고 독립적으로 GI 데이?…
Declarações
The authors have nothing to disclose.
Acknowledgements
이 작품은 게놈 캐나다, 온타리오 유전체학 연구소, 그리고 JG 및 AE AG에 대한 건강 연구 보조금의 캐나다 연구소의 자금에 의해 지원되었다 Vanier 캐나다 대학원 장학금의 수상자이다.
Materials
| I. Antibiotics | 2 | 36471 Remove |
||||
| Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
| Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
| Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
| 2. Luria-Bertani medium | 6 | 36474 Remove |
||||
| LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
| Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
| 3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
| Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
| pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
| Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
| Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
| 4. Primers | 14 | 36486 Remove |
||||
| pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
| Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
| Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
| 5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
| Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
| 10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
| 10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
| 25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
| Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
| Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
| Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
| 10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
| Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
| Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
| 0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
| DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
| 6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
| Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
| Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
| QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
| 7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
| Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
| Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
| Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
| 0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
| 42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
| Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
| 32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
| 32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
| RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
| 96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
| 96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
| 8. Imaging Equipments | 47 | 36515 Remove |
||||
| Camera stand | Kaiser | 48 | 36516 Remove |
|||
| Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
| Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
| 9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
| 10% bleach | Any Vendor | 52 | 36520 Remove |
|||
| 70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
| Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
| Flow hood | Any Vendor | 55 | 36523 Remove |
|||
| Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
| 10. Labware | 57 | 36525 Remove |
||||
| 50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
| 1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
| 250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
| 15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
| Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
| Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
| 96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
| Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
| plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
| Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
| -80 °C freezer | Any Vendor | 68 | 36536 Remove |
Referências
- Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. Functional maps of protein complexes from quantitative genetic interaction data. PLoS Comput. Biol. 4, e1000065 (2008).
- Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. Charting the genetic interaction map of a cell. Curr. Opin. Biotechnol. 22, 66-74 (2011).
- Costanzo, M., et al. The genetic landscape of a cell. Science. 327, 425-4231 (2010).
- Fiedler, D., et al. Functional organization of the S. cerevisiae phosphorylation network. Cell. 136, 952-963 (2009).
- Roguev, A., et al. Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast. Science. 322, 405-4010 (2008).
- Schuldiner, M., et al. Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell. 123, 507-519 (2005).
- Wilmes, G. M., et al. A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing. Mol. Cell. 32, 735-746 (2008).
- Babu, M., et al. Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes. Mol. Biosyst. 12, 1439-1455 (2009).
- Butland, G., et al. coli synthetic genetic array analysis. Nat. Methods. 5, 789-7895 (2008).
- Typas, A., et al. Regulation of peptidoglycan synthesis by outer-membrane proteins. Cell. 143, 1097-10109 (2010).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 2006-200008 (2006).
- Babu, M., et al. Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways. PLoS Genet. 7, e1002377 (2011).
- Nichols, R. J., et al. Phenotypic landscape of a bacterial cell. Cell. 144, 143-156 (2011).
- Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli. Methods Mol Biol. 765, 125-153 (2011).
- Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).
- Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).
- Typas, A., et al. quantitative analyses of genetic interactions in. E. coli. Nat. Methods. 5, 781-787 (2008).
- Zeghouf, M., et al. Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468 (2004).
- Davierwala, A. P., et al. . , 1147-1152 (2005).
- Breslow, D. K., et al. A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat. Methods. 5, 711-718 (2008).
- Babu, M., et al. Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli. Methods Mol. Biol. 564, 373-400 (2009).
- Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
- Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7, (2009).
- Anderson, R. P., Roth, J. R. Tandem genetic duplications in phage and bacteria. Annu. Rev. Microbiol. 31, 473-505 (1977).
- Boone, C., Bussey, H., Andrews, B. J. Exploring genetic interactions and networks with yeast. Nat. Rev. Genet. 8, 437-449 (2007).
- Collins, S. R., et al. Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map. Nature. 446, 806-8010 (2007).
- Le Meur, N., Gentleman, R. Modeling synthetic lethality. Genome Biol. 9, R135 (2008).
- Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 294, 2364-2368 (2001).
- Tong, A. H., et al. Global mapping of the yeast genetic interaction network. Science. 303, 808-813 (2004).
- Wong, S. L., et al. Combining biological networks to predict genetic interactions. Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).
- van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat. Methods. 6, 767-772 (2009).
- Gagarinova, A., Emili, A. Genome-scale genetic manipulation methods for exploring bacterial molecular biology. Mol. Biosyst. 8, 1626-1638 (2012).
- Dewey, C. N., et al. Positional orthology: putting genomic evolutionary relationships into context. Brief Bioinform. 12, 401-412 (2011).
- St Onge, R. P., et al. Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions. Nat. Genet. 39, 199-206 (2007).
Tags
Bacterial Functional NetworksPathwaysEscherichia ColiSynthetic Genetic ArraysPhenotypesPhysical InteractionsFunctional InteractionsGene-gene InteractionsGenetic InteractionsGI ScreensEpistatic DependenciesFunctional RelationshipsLarge-scale GI MapsProkaryotesFunctional AnnotationBacterial GenomesQuantitative Bacterial GI Screening MethodsE. Coli Synthetic Genetic Array (eSGA) Screening ProcedureGenome-scale Screening
Citar este artigo
Gagarinova, A., Babu, M., Greenblatt, J., Emili, A. Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays. J. Vis. Exp. (69), e4056, doi:10.3791/4056 (2012).