We describe a protocol for deriving lentiviral-based reprogrammed and characterized factor-free human induced pluripotent stem cells and conversion into putative clinical-grade conditions.
Human induced pluripotent stem cells (hiPSCs) can be generated with lentiviral-based reprogramming methodologies. However, traces of potentially oncogenic genes remaining in actively transcribed regions of the genome, limit their potential for use in human therapeutic applications1. Additionally, non-human antigens derived from stem cell reprogramming or differentiation into therapeutically relevant derivatives preclude these hiPSCs from being used in a human clinical context2. In this video, we present a procedure for reprogramming and analyzing factor-free hiPSCs free of exogenous transgenes. These hiPSCs then can be analyzed for gene expression abnormalities in the specific intron containing the lentivirus. This analysis may be conducted using sensitive quantitative polymerase chain reaction (PCR), which has an advantage over less sensitive techniques previously used to detect gene expression differences3. Full conversion into clinical-grade good manufacturing practice (GMP) conditions, allows human clinical relevance. Our protocol offers another methodology—provided that current safe-harbor criteria will expand and include factor-free characterized hiPSC-based derivatives for human therapeutic applications—for deriving GMP-grade hiPSCs, which should eliminate any immunogenicity risk due to non-human antigens. This protocol is broadly applicable to lentiviral reprogrammed cells of any type and provides a reproducible method for converting reprogrammed cells into GMP-grade conditions.
Adult human cells have been shown to be capable of undergoing epigenetic remodeling and reprogramming, as a result of lentiviral-based expression of four key transcription factors4,5. An important advancement in the reprogramming field was the use of a single excisable lentiviral stem cell cassette (STEMCCA), which housed all four reprogramming transcription factors that allowed a precise stoichiometric ratio of protein expression6. Additionally, when transduced in specific multiplicity of infection ranges, STEMCCA can lead to predominantly single genomic integration events during the reprogramming process7. The introduction of an excisable version of STEMCCA, which utilizes Cre/loxP technology followed by excision of the reprogramming vector after derivation of the stem cell line, enabled factor-free human induced pluripotent stem cell (hiPSC) lines to be derived8. Additionally, in order to enhance therapeutic applications of hiPSCs, a novel, quick, and readily applicable methodology for good manufacturing practice (GMP)-grade cell line conversion, from xeno-containing to xeno-free conditions, needed to be implemented. Here, we discuss a relevant methodology that more precisely assesses integrated gene expression differences, specifically when integrated into an intron, and clinical-grade cell conversion into putative GMP conditions.
Previous research has used only relatively insensitive microarray transcriptional analysis to analyze gene expression differences in integrated genes after STEMCCA transduction3,9. Here, we introduce the methodology of sensitive quantitative polymerase chain reaction (PCR) analysis, to further examine integrated gene expression differences. Importantly, current safe-harbor criteria discard hiPSCs that have genes with viral integrations, thus limiting the applicability of these cells for downstream human cellular therapeutics9. We propose that the status quo may change with the use of fully characterized and transgene-free intronically reprogrammed hiPSCs. Additionally, we introduce a robust GMP-grade cell conversion protocol that can be readily applied to a variety of different cell types, which were originally derived under xeno-containing conditions10. This provides significant opportunities for the development of future cell reprogramming experiments, which require clinical-grade conditions to maintain human therapeutic relevance.
These methodologies provide a foundation upon which current safe-harbor criteria may be expanded to include characterized STEMCCA reprogrammed hiPSC lines that maintain a normal gene expression profile after STEMCCA excision from the integrated intron. Also, full conversion into clinical-grade conditions, free from non-human animal antigens, will help to incorporate many more cell types, which have previously been reprogrammed and characterized only in xeno-containing conditions. These methodologies combined, are persuasive grounds for the US Food and Drug Administration (FDA) to consider expanding their limited approval from human embryonic stem cell (ESC)-based therapeutics to hiPSC-based therapeutics11.
We recently detailed the derivation of a factor-free hiPSC line that was fully characterized and converted into putative clinical-grade conditions10. Here, we detail the protocol for hiPSC derivation by utilizing the STEMCCA lentivirus. These stem cells then undergo an excision process followed by gene expression characterization. Finally, the hiPSCs are converted over into GMP-grade conditions by a slow conversion methodology.
NOTE: This method was used in the research reported in Awe et al.10.
1. Reprogramming Adult Human Dermal Fibroblasts with STEMCCA
2. Vector Integration Site Analysis and STEMCCA Excision
3. Quantitation of Gene Expression Differences by Using Quantitative PCR from Pre- and Post-excised hiPSCs
4. Conversion into GMP-grade Conditions
5. Characterizing GMP-grade Post-excised hiPSCs
We present a protocol for deriving clinical-grade factor-free hiPSCs by using the STEMCCA lentiviral-based reprogramming approach. Figure 1A shows a representative picture of three different pre-excised hiPSC lines, after reprogramming with the STEMCCA approach on a layer of MEFs. The primary advantage of the STEMCCA reprogramming approach lies in the consistent reprogramming success achieved by multiple scientists, in different research groups and locations. Figure 1B presents the post-excision reverse transcription-PCR gel, showing one particular subclone (2.3) which is completely free from the STEMCCA lentivirus, as evidenced by the lack of an amplicon band specific for a particular sequence endogenous to STEMCCA. Figure 2A shows the pre-converted hiPSCs on a xeno containing matrix and post-excised xeno-free GMP-grade hiPSCs on synthetic matrix. Quantitation of standard pluripotency-associated factors (SOX2, OCT4, and NANOG) by using QPCR is illustrated in Figure 2B. Pre-converted and post-converted hiPSCs to GMP-grade conditions were tested through flow cytometry for the sialic acid N-glycolylneuraminic acid, indicative of non-human antigens, as shown in Figure 2C.
Figure 1: Representative human pluripotent stem cell cassette (hSTEMCCA)-derived human induced pluripotent stem cell (hiPSC) lines. (A) All three derived lines were analyzed with nrLAM-PCR technology and only the presented C8 line was found to have one integration into the PRPF39 gene. Only this line, due to the safe intronic STEMCCA integration, was selected to undergo Adeno-Cre-PuroR selection for Cre-mediated excision. (B) Adeno-Cre mediated STEMCCA excision out of the C8 line. Primers against unique nucleotide sequences found in STEMCCA-endo-Myc-s and A-WPRE- found that only one subclone (2.3 post-excised iPSCs) were properly excised and free of transgenic transcription factors from the integrated provirus. Bars = 100 μm. This figure has been modified from Awe et al.10.
Figure 2: Conversion of hiPSCs from xeno-containing to clinical grade GMP xeno-free conditions and characterization. (A) Representative hiPSC line that has been converted from xeno-containing (research grade matrix) to xeno-free (synthetic substrate) conditions under current good manufacturing practice (GMP) conditions. (B) Quantitative polymerase chain reaction to assay for proper pluripotency associated gene expression post-conversion into GMP grade conditions. (C) In addition to the standard sterility tests to ensure GMP compatibility, a flow cytometry-based assay testing for the non-human antigen, N-glycolylneuraminic acid, is used to show that post-converted hiPSCs eliminate all sialic acid detection (1% with post-excised cells on matrix compared to 0% with post-excised cells on a synthetic substrate). Mouse embryonic fibroblasts and a hiPSC line derived under GMP conditions served as positive and negative controls, respectively, in this experiment. Bars = 100 µm. hESC, human embryonic stem cell; PESS, post-excised synthetic substrate; PEM, post-excised matrix. This figure has been modified from Awe et al.10.
Gene Name | Forward Primer 5'-3' | Reverse Primer 5'-3' | Probe # |
QRT-hPOU5F1 | gaagttaggtgggcagcttg | tgtggccccaaggaatagt | 13 |
QRT-hSOX2 | gggggaatggaccttgtatag | gcaaagctcctaccgtacca | 65 |
QRT-hNANOG | cagtctggacactggctgaa | cacgtggtttccaaacaaga | 55 |
Table 1: Primers used for quantitative PCR analysis.
We describe a methodology of deriving factor-free hiPSCs and making them clinically relevant by converting these cells into GMP-grade conditions for downstream cell differentiation in future human therapeutics. Although this protocol is broadly applicable to a variety of cell types, we chose to reprogram human dermal fibroblasts, due to the ease of extraction from the patient and their applicability to personalized human therapeutics. Once limitations are remedied as far as full differentiation into clinically relevant cell derivatives is concerned14, the presented conversion into GMP-grade conditions will become even more relevant to a variety of different cell types.
The first part of this study involves reprogramming human fibroblasts with the STEMCCA lentivirus. This technique was chosen in large part due to its reproducibility, relatively high reprogramming efficiency (0.02%), and robust ability to reprogram across many different cell types10. This technique is superior to other reprogramming methodologies such as sendai virus, episomal plasmids, and synthetic mRNA based reprogramming that suffer from lower reprogramming efficiencies and reproducibility10. Although there is a correlation between HIV-based vectors integrating into increased gene activity hotspots15, there is no guarantee that they will integrate into a gene, much less into a safer area of a gene, the intron. Thus this obstacle represents a notable limitation to this approach. Additionally, this integration site preference into a safer genomic location decreases with more integrations throughout the genome. Therefore, it is imperative that proper lentiviral provirus integration site and integration number be properly interrogated by sensitive techniques such as nrLAM-PCR technology. Future reprogramming utilizing zinc finger nuclease technology, TALEN, or CRISPR/Cas9-based gene targeting (via homologous recombination) may further guide this field into specific loci for reprogramming16.
Once the human fibroblasts are properly reprogrammed and colonies have been derived, another critical aspect of this protocol is the Adeno-Cre-PuroR expression for selection of post-excised hiPSCs. It is important to consider re-exposing the colonies to puromycin after a few weeks of cell culture, in order to ensure that all the adenovirus has been diluted out through cell replication and has not sporadically integrated into the genome. Improper integration into the genome of the adenovirus would represent a safety concern for personalized cellular therapeutics.
Conversion into GMP-grade conditions is an important step in introducing clinical applicability to these factor-free hiPSCs. It is important to change only one condition at a time when converting these cells over to xeno-free conditions; start by converting the cells into xeno-free media through the slow conversion methodology. The hiPSCs cannot tolerate a media change and a substrate change at the same time. Once the cells are passaging regularly with normal morphology in the new media conditions, begin the transition onto the xeno-free substrate. If specific cell types are having trouble transferring over onto the recommended substrate, it is feasible to consider trying other xeno-free substrates on the market.
In conclusion, the robust and broad applicability of this reprogramming technique along with the GMP-grade conversion should allow easy reproducibility and serves as a foundation for future hiPSC-based derivative cell culture for human therapeutics.
The authors have nothing to disclose.
We would like to thank Patrick C. Lee, Cyril Ramathal, and Saravanan Karumbayaram (SK) for their assistance in performing the iPSC derivation and characterization experiments; Aaron Cooper for performing the iPSC analysis experiments; Vittorio Sebastiano and Renee A. Reijo Pera for directing the initial reprogramming efforts; SK, William E. Lowry, Jerome A. Zack, and Donald B. Kohn for directing the establishment of the UCLA GMP facilities permitting the conversion and characterization of clinical-grade iPSCs; Gustavo Mostoslavsky for providing us with the STEMCCA polycistronic reprogramming vector. This work is based on a research collaboration with Fibrocell Science and the Clinical Investigations for Dermal Mesenchymally Obtained Derivatives (CIDMOD) Initiative to generate safe personalized cellular therapeutics. This work was supported by funding from the Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research at UCLA, The Phelps Family Foundation, Fibrocell Science, Inc., and the UCLA CTSI Scholar’s Award to JAB.
Name | Company | Catalog Number | Comments |
Media and reagents | |||
DMEM/F12 (basal media) | Invitrogen (Carlsbad, CA, USA) | 11330057 | |
Fetal bovine serum | Invitrogen | 16000044 | |
Minimum essential medium (MEM) non-essential amino acids (NEAA), 100x | Invitrogen | 11140050 | |
Glutamax, 100x | Invitrogen | 35050-061 | |
PenStrep, penicillin-streptomycin, 100x | Invitrogen | 15140-122 | Thaw at 4 °C, aliquot and store at −20 °C |
Knockout serum replacement | Invitrogen | 10828028 | Thaw at 4 °C, aliquot and store at −20 °C |
Trypsin/EDTA, 0.5% | Invitrogen | 15400-054 | Dilute stock out to 0.05% in 1x PBS |
Basic fibroblast growth factor | GlobalStem (Rockville, MD, USA) | GSR-2001 | Reconstitute to 10 µg/ml stock in 0.1% bovine serum albumin dissolved in 1x PBS and store at −80 °C |
β-mercaptoethanol | Millipore (Billerica, MA, USA) | ES-007-E | |
Matrigel (basement membrane matrix) | BD Biosciences (San Jose, CA, USA) | 356231 | Dilute stock Matrigel vial with 10 ml of DMEM/F12 while on ice for a 1:2 dilution. Aliquot and store at −20 °C |
CELLstart (Synthetic Substrate) | Invitrogen | A1014201 | |
Stemmolecule Y27632 | Stemgent (Cambridge, MA, USA) | 04-0012-02 | |
Puromycin | Invitrogen | A1113802 | |
LightCycler 480 Probes Master | Roche (Basel, Switzerland) | 4707494001 | |
ProFreeze-CDM Medium/freezing medium | Lonza (Basel, Switzerland) | 12-769E | |
Dimethyl sulfoxide | Sigma-Aldrich (St. Louis, MO, USA) | D8418 | |
PBS | Invitrogen | 14190-250 | |
100 BP DNA Ladder | Invitrogen | 15628019 | |
SYBR Safe DNA Gel Stain 10000x | Invitrogen | S33102 | |
Agarose | Bio-Rad Laboratories, Inc. (Hercules, CA, USA) | 161-3101 | |
Gelatin, from porcine skin | Sigma-Aldrich | G1890-100G | Make stock at 0.2% in PBS, autoclave and store at room temperature |
mTeSR1 | StemCell Technologies (Vancouver, BC, Canada) | 5850 | Combine Supplement 5X with the basic medium, aliquot and store at 4 °C for up to 2 weeks. |
Stemedia NutriStem XF/FF Culture Medium | Stemgent | 05-100-1A | Thaw at 4 °C O/N, aliquot and store at 4 °C for up to 2 weeks. |
Primocin | InvivoGen (San Diego, CA, USA) | ant-pm-1 | |
Accutase (Dissociation Reagent) | Invitrogen | A1110501 | |
Donkey anti-Chicken IgG AlexaFluor 488 | Jackson ImmunoResearch (West Grove, PA, USA) | 703-546-155 | |
Polybrene/transfection agent | Millipore | TR-1003-G | |
Plasticware | |||
12-well plates | VWR (West Chester, PA, USA) | 29442-038 | |
6-well plates | VWR | 29442-042 | |
10-cm plates | Sigma-Aldrich | Z688819 | |
18-gauge needle | Fisher Scientific (Pittsburgh, PA, USA) | 148265D | |
21-gauge needle | Fisher Scientific | 14-829-10D | |
Equipment | |||
BD LSRII Flow Cytometer | KSystem by Nikon (Tokyo, Japan) | ||
BD FACSDiva Version 6.1.3 Software | BD Biosciences | ||
Kits | |||
PureLink Genomic DNA Mini Kit | Invitrogen | K182000 | |
KAPA HiFi Hotstart ReadyMix PCR Kit | KAPA Biosystems (Wilmington, MA, USA) | KK2601 | |
High Pure RNA Isolation Kit | Roche | 11828665001 | |
Transcriptor First Strand cDNA Synthesis Kit | Roche | 4379012001 | |
Sialix anti-Neu5Gc Basic Pack Kit | Sialix (Newton, MA, USA) | Basic Pack | |
Media | |||
Combined media 1 | StemCell Technologies and Stemgent | Consists of equal parts mTeSR1 and Nutristem | |
Combined media 2 | StemCell Technologies and Stemgent | Consists of equal parts TeSR2 and Nutristem | |
HUF Media | Dulbecco’s modified Eagle’s medium/F12 [DMEM/F12] supplemented with 10% fetal bovine serum, 1x non-essential amino acids, 1x Glutamax, and 1x Primocin | ||
Human Pluripotent Stem Cell Media | DMEM/F12 supplemented with 20% knockout serum replacement, 1x Glutamax, 1x non-essential amino acids, 1x Primocin, 1x β-mercaptoethanol, and 10 ng/ml basic fibroblast growth factor | ||
DMEM/F12, Dulbecco’s modified Eagle’s medium/F12; PBS, phosphate-buffered saline. |