פרוטוקול זה מדגים כיצד ליצור מסומן פלורסנטי, גידולים המשובטים מוגדר גנטית בעין תסיסנית / דיסקים דמותי מחושים (EAD). הוא מתאר כיצד לנתח את EAD והמוח מן הזחלים instar השלישי וכיצד לעבד אותם לחזות ולכמת שינויים בהתבטאות גנים הפולשנות הגידול.
Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.
סרטן מייצג את אחד קבוצה הטרוגנית גנטית ביותר של מחלות, אשר שכיחות ותמותה גדל באופן דרמטי, במיוחד בקרב קשישים ברחבי העולם. הסרטן שמקורו clonally מתא ייזום גידול כי נמלט מנגנוני מדכא גידולים טמונים ומחלק יצא מכלל שליטה. ההצטברות ההדרגתית של נגעים גנטיים בשיתוף פעולה לקידום צמיחה, שגשוג תנועתיות תוך עיכוב מוות והבחנה הופכת את יתר השפירה הראשוני לתוך גידול ממאיר, הגרורה וקטלנית מאוד. זה הפך להיות ברור כי בנוסף שינויים גנטיים, התקדמות הגידול דורש שינויים stroma שמסביב crosstalk בין הגידול לבין מספר סוגי תאים (למשל, פיברובלסטים, תאי מערכת החיסון ואת אנדותל) ב microenvironment שלה. הבנת העקרונות המולקולריים שבבסיס שינוי ממאיר כולל אינטראקציות stroma גידול היא בעל חשיבות רבה לפיתוח מונע וטיפולtion ואסטרטגיות המיון המוקדם, כמו גם טיפולים חדשים ויעילים להילחם גרורות סרטן עמידות לתרופות.
זבוב הפרות תסיסנית הפכו למערכת אטרקטיבית חקר הסרטן 1-4 בשל הזמן ההדור המהיר שלה, שימור מדהים של איתות צמתים בין זבובים ובני האדם, יתירות גנטית מוגבלת ועושר של כלים גנטיים מתקדמים המאפשרים מניפולציה של כמעט כל גן ב באופן מצומצם זמנית מרחבית. גנטי גידולים מוגדרים של ממאירות שונות יכולים להיות מהונדסים reproducibly תסיסנית ידי החדרת gain- ופסד של פונקצית מוטציות קבוצת משנה של אבות ב רקמת סוג ברה אחר באמצעות טכניקת MARCM 5. הכלי MARCM משלב FLP / FRT (FLP recombinase / FLP זיהוי מטרות) בתיווך רקומבינציה mitotic 6 עם FLP-אאוט 7 ו Gal4 / כטב"מ (רצף הפעלת Upstream) גן המטרה 8מערכות ביטוי 9. עם ביטוי שיטה זו של כל transgene כטב"מ מבוסס, כולל אונקוגן או cDNAs חלבון פלואורסצנטי או חזרות DNA הפוכות עבור להשתקת גני מושרה dsRNA, יוגבל שיבוט של תאים שאבד מוקד גנטי ספציפי וכן מדכא Gal4 עקב רקומבינציה (איור 1 א). תיקוני משובטים מסומנים פלואורסצנטי ירוק (GFP) או חלבוני ניאון אדום (למשל, RFP, DsRed, mCherry) ניתן לעקוב בקלות ברחבי פיתוח, מבודד ונותח. חשוב לציין, התנהגותם ניתן להשוות ישירות לרקמת סוג הבר הסמוכה. לפיכך, שאלות ענייניות לתא אוטונומי והשפעות חד אוטונומיות של נגעים גנטיים ניתן ללמוד בנוחות. בדומה ליונקים, רק שיבוטים שבו מספר נגעים שבעור משולבים להפוך לממאירים תסיסנית ו לשחזר סימני היכר עיקריים של סרטן יונק. הם overproliferate, להתחמק אפופטוזיס, לגרום דלקת, להיות בן אלמוות invasive, ובסופו של דבר הורג את המארח 10-17.
כאן, אנו מתארים פרוטוקול ליצור גנטי מוגדרים גידולים המשובטים בעיניים / מחושים ומוח הרקמות של זחלים תסיסנית באמצעות טכניקת MARCM. השיטה מסתמכת על מנייה בודק MARCM המבטא את recombinase FLP שמרים בשליטת המשפר חסר העיניים (eyFLP) 18,19. בדרך זו, שיבוטי GFP שכותרתו נוצרים בשני האפיתל peripodial ואת העמודים של EAD ואת neuroepithelium של המוח בכל שלבים עובריים זחל (איור 1 א ', ב' ו-התייחסות 20). משובטים ניתן בעקבות בקלות עד לבגרות כמו EAD מפתחת לתוך עין המבוגרת, כמוסת האנטנה והראש בעוד neuroepithelium מוליד neuroblasts המייצרים נוירונים באונה אופטיים מובחנים.
כדי להקל על אפיון מולקולרי, פונקציונלי פנוטיפי נרחב של רקמת הפסיפס, אנחנו דהסופר פרוטוקול לנתיחה של EAD והמוח מן זחלי instar השלישיים מתאר כיצד לעבד אותם במשך שלושה יישומים שונים: (i) זיהוי של כתבי ניאון מהונדסים immunostaining, (ii) כימות הפולשנות גידול (iii) ניתוח ביטוי גנים משנה באמצעות כמותי בזמן אמת PCR (qRT-PCR) או רצף mRNA תפוקה גבוהה (mRNA-seq) (תרשים 1C).
פרוטוקול immunostaining יכול לשמש כדי לחזות חלבון כלשהו של עניין עם נוגדן ספציפי. כתבי תעתיק פלורסנט מהונדסים לספק מידע spatiotemporal נוח ומדויק על פעילות מסלול איתות מסוימת. תא שושלת כתבים ספציפיים, ומצד שני, משקפים שינויים איכותיים וכמותיים אוכלוסיות תאים בתוך הרקמה פסיפס ובקרב גידולים של גנוטיפים ברורים. כימות התנהגות פולשנית מקל על השוואה של ממאירות הגידול בין גנוטיפים. לבסוף, פרוטוקול המתאר איסוף ועיבוד של EAD פסיפס עבור בידוד RNA הוא מתאים הן יישומים במורד הזרם קטן בקנה מידה גדול כגון שעתוק לאחור ולאחריו qRT-PCR ו-seq mRNA רחב הגנום, בהתאמה. הנתונים האיכותיים והכמותיים המתקבלים מבחנים אלה מספקים תובנות רומן לתוך ההתנהגות החברתית של גידולים משובטים. יתר על כן, הם מייצרים בסיס איתן ללימודים תפקודיים על עצם את התפקיד של גנים בודדים, רשתות גנטיות microenvironment גידול בשלבים שונים והיבטים של tumorigenesis.
הטכניקות כדי ליצור פסיפסים גנטיים תסיסנית הם בין הכלים המתוחכמים ביותר לניתוח וטיפול גן פונקצית 33. מערכת eyFLP-MARCM הוכיחה חזקה ויציבה שכן היא מאפשרת האינדוקציה של מסומן באופן ויזואלי, שיבוטים מוגדרים גנטי באופן מוגבל מרחבית, כלומר, ברקמות שבו משפר חסר…
The authors have nothing to disclose.
We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.
Agar | Gewürzmühle Brecht, Eggenstein, Germany | 00262-0500 | Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C. |
Corn syrup | Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany | 01939 | |
Propionic acid | Carl Roth GmbH, Karlsruhe, Germany | 6026.1 | |
Cornmeal | ReformKontor GmbH, Zarrentin, Germany | 4010155063948 | |
Malt extract | CSM Deutschland GmbH, Bremen, Germany | 728985 | |
Soy flour | Stockmeier Food GmbH, Herford, Germany | 1000246441010 | |
Yeast | Werner Ramspeck GmbH, Schwabach, Germany | 210099K | |
Methyl-4-benzoate/ Nipagin | Sigma-Aldrich, Deisenhofen, Germany | H5501 | Prepare a 15% stock solution with 70% EtOH |
Drosophila fly food vials | Kisker Biotech, Steinfurt, Germany | 789008 | |
Vial plugs | K-TK e.K., Retzstadt, Germany | 1002 | |
Drosophila fly food bottles | Greiner Bio-One, Frickenhausen, Germany | 960177 | |
Bottle plugs | K-TK e.K., Retzstadt, Germany | 1002 S | |
Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n | Sigma-Aldrich, Deisenhofen, Germany | 81381 | Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C. |
1,4-Diazabicyclo[2.2.2]octane/ DABCO | Sigma-Aldrich, Deisenhofen, Germany | D2522 | |
Triton X-100 | Sigma-Aldrich, Deisenhofen, Germany | 9002-93-1 | |
Phosphate-buffered saline/ PBS | 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O | ||
PBST | 0.1% Triton X-100 in PBS | ||
Paraformaldehyde/ PFA | Sigma-Aldrich, Deisenhofen, Germany | 158127 | 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes) |
Bovine Serum Albumin/ BSA | Sigma-Aldrich, Deisenhofen, Germany | A3059 | Blocking solution recipe: Dissolve 0.3% BSA in PBST |
4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI | Carl Roth GmbH, Karlsruhe, Germany | 6335 | DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST. |
Alexa Flour 546 Phalloidin | Invitrogen, Karlsruhe, Germany | A22283 | Used in dilution 1:500 in PBST. |
Mouse anti-H2 antibody | Kurucz et al., 2003 | Used in dilution 1:500 in blocking solution | |
Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) | Jackson ImmunoResearch, Suffolk, UK | 715-175-151 | Used in dilution 1:500 in blocking solution |
Dumont #5 forceps | Fine Science Tools, Heidelberg, Germany | 11295-10 | |
Glass embryo dish (30 mm) | Thermo Scientific, Schwerte, Germany | E90 | |
Tungsten needles | Fine Science Tools, Heidelberg, Germany | 10130-20 | |
Nickel Plated Pin Holder | Fine Science Tools, Heidelberg, Germany | 26018-17 | |
Microscope slides | VWR, Darmstadt, Germany | 631-1553 | |
Coverslips 22 x 22 mm (#1 Menzel-Gläser) | VWR, Darmstadt, Germany | 631-1336 | |
Coverslips 24 x 50 mm (0.13-0.16 mm) | Thermo Scientific, Schwerte, Germany | 1076371 | |
Kimtech Science Precision Wipes | Thermo Scientific, Schwerte, Germany | 06-677-70 | |
Dissecting stereomicroscope | Olympus, Hamburg, Germany | SZX7 (DF PLAPO 1X-4 Japan) | |
Fluorescent stereomicroscope | Olympus, Hamburg, Germany | SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera | Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11. |
Confocal microscope | Olympus, Hamburg, Germany | FV1000 | Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software |
Drosophila cooled incubator | Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany | Sanyo MIR553 | |
Squirt bottle | VWR, Darmstadt, Germany | 215-8105 | |
BD Clay Adams Nutator Mixer | VWR, Darmstadt, Germany | 15172-203 | |
ELMI Digital Rocking Shaker | VWR, Darmstadt, Germany | DRS-12 | |
5 PRIME Isol-RNA Lysis Reagent | VWR, Darmstadt, Germany | 2302700 | The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596). |
Diethyl pyrocarbonate/ DEPC | Sigma-Aldrich, Deisenhofen, Germany | D5758 | Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave. |
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 15593-031 | |
Chloroform | Merck, Darmstadt, Germany | 102445 | |
TURBO DNase (2 U/µl) | Thermo Scientific, Schwerte, Germany | AM2238 | |
Invitrogen UltraPure Glycogen | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 10-814-010 | |
Sodium acetate trihydrate | VWR, Darmstadt, Germany | 27652.232 | Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2 |
2-Propanol | Merck, Darmstadt, Germany | 109634 | |
Ethanol | Merck, Darmstadt, Germany | 100983 | Prepare a 75% EtOH dilution with DEPC-H2O. |
UV/Vis-Spectrophotometre NanoDrop ND-8000 | Thermo Scientific, Schwerte, Germany | ND-8000 | |
Eppendorf Microcentrifuge (Refrigerated) | Thermo Scientific, Schwerte, Germany | 5417R | |
Experion RNA StdSens Analysis Kit | Bio-Rad Laboratories GmbH, München, Germany | 7007103 | |
Experion Automated Electrophoresis Station | Bio-Rad Laboratories GmbH, München, Germany | 7007010 | |
SuperScript III Reverse Transcriptase | Thermo Scientific, Schwerte, Germany | 18080044 | |
Oligo d(T) Primer | Integrated DNA Technologies, Leuven, Belgium | Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C | |
dNTP Mixture | Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France | 4030 | Store aliquots of 25 µl at -20°C |
CFX96 Touch Real-Time PCR Detection System | Bio-Rad Laboratories GmbH, München, Germany | 1855195 | |
iQ SYBR Green Supermix | Bio-Rad Laboratories GmbH, München, Germany | 170-8882 | |
Hard-Shell PCR Plates 96-well, thin wall | Bio-Rad Laboratories GmbH, München, Germany | HSP9601 | |
Microseal 'B' Film | Bio-Rad Laboratories GmbH, München, Germany | MSB1001 | |
rp49 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' TCCTACCAGCTTCAAGATGAC 3' | |
rp49 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' CACGTTGTGCACCAGGAACT 3' | |
mmp1 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' AGGGCGACAAGTACTACAAGCTGA 3' | |
mmp1 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' ACGTCTTGCCGTTCTTGTAGGTGA 3' |