JoVE Journal > Cancer Research
Summary
Abstract
Introduction
Protocol
Resultados
Discussion
Declarações
Acknowledgements
Materials
Referências
Tadução automática
Please note that all translations are automatically generated. Click here for the English version.
Pesquisa do Câncer

ה<em> תסיסנית</em> דגם גידול דיסק דמותי: ויזואליזציה וכימות של ביטוי גנים סרטניים הפולשנות שימוש פסיפסים גנטי

Published: October 06, 2016
doi:
10.3791/54585
,
1Institute for Genetics, Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD),University of Cologne

Summary

פרוטוקול זה מדגים כיצד ליצור מסומן פלורסנטי, גידולים המשובטים מוגדר גנטית בעין תסיסנית / דיסקים דמותי מחושים (EAD). הוא מתאר כיצד לנתח את EAD והמוח מן הזחלים instar השלישי וכיצד לעבד אותם לחזות ולכמת שינויים בהתבטאות גנים הפולשנות הגידול.

Abstract

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

Introduction

סרטן מייצג את אחד קבוצה הטרוגנית גנטית ביותר של מחלות, אשר שכיחות ותמותה גדל באופן דרמטי, במיוחד בקרב קשישים ברחבי העולם. הסרטן שמקורו clonally מתא ייזום גידול כי נמלט מנגנוני מדכא גידולים טמונים ומחלק יצא מכלל שליטה. ההצטברות ההדרגתית של נגעים גנטיים בשיתוף פעולה לקידום צמיחה, שגשוג תנועתיות תוך עיכוב מוות והבחנה הופכת את יתר השפירה הראשוני לתוך גידול ממאיר, הגרורה וקטלנית מאוד. זה הפך להיות ברור כי בנוסף שינויים גנטיים, התקדמות הגידול דורש שינויים stroma שמסביב crosstalk בין הגידול לבין מספר סוגי תאים (למשל, פיברובלסטים, תאי מערכת החיסון ואת אנדותל) ב microenvironment שלה. הבנת העקרונות המולקולריים שבבסיס שינוי ממאיר כולל אינטראקציות stroma גידול היא בעל חשיבות רבה לפיתוח מונע וטיפולtion ואסטרטגיות המיון המוקדם, כמו גם טיפולים חדשים ויעילים להילחם גרורות סרטן עמידות לתרופות.

זבוב הפרות תסיסנית הפכו למערכת אטרקטיבית חקר הסרטן 1-4 בשל הזמן ההדור המהיר שלה, שימור מדהים של איתות צמתים בין זבובים ובני האדם, יתירות גנטית מוגבלת ועושר של כלים גנטיים מתקדמים המאפשרים מניפולציה של כמעט כל גן ב באופן מצומצם זמנית מרחבית. גנטי גידולים מוגדרים של ממאירות שונות יכולים להיות מהונדסים reproducibly תסיסנית ידי החדרת gain- ופסד של פונקצית מוטציות קבוצת משנה של אבות ב רקמת סוג ברה אחר באמצעות טכניקת MARCM 5. הכלי MARCM משלב FLP / FRT (FLP recombinase / FLP זיהוי מטרות) בתיווך רקומבינציה mitotic 6 עם FLP-אאוט 7 ו Gal4 / כטב"מ (רצף הפעלת Upstream) גן המטרה 8מערכות ביטוי 9. עם ביטוי שיטה זו של כל transgene כטב"מ מבוסס, כולל אונקוגן או cDNAs חלבון פלואורסצנטי או חזרות DNA הפוכות עבור להשתקת גני מושרה dsRNA, יוגבל שיבוט של תאים שאבד מוקד גנטי ספציפי וכן מדכא Gal4 עקב רקומבינציה (איור 1 א). תיקוני משובטים מסומנים פלואורסצנטי ירוק (GFP) או חלבוני ניאון אדום (למשל, RFP, DsRed, mCherry) ניתן לעקוב בקלות ברחבי פיתוח, מבודד ונותח. חשוב לציין, התנהגותם ניתן להשוות ישירות לרקמת סוג הבר הסמוכה. לפיכך, שאלות ענייניות לתא אוטונומי והשפעות חד אוטונומיות של נגעים גנטיים ניתן ללמוד בנוחות. בדומה ליונקים, רק שיבוטים שבו מספר נגעים שבעור משולבים להפוך לממאירים תסיסנית ו לשחזר סימני היכר עיקריים של סרטן יונק. הם overproliferate, להתחמק אפופטוזיס, לגרום דלקת, להיות בן אלמוות invasive, ובסופו של דבר הורג את המארח 10-17.

כאן, אנו מתארים פרוטוקול ליצור גנטי מוגדרים גידולים המשובטים בעיניים / מחושים ומוח הרקמות של זחלים תסיסנית באמצעות טכניקת MARCM. השיטה מסתמכת על מנייה בודק MARCM המבטא את recombinase FLP שמרים בשליטת המשפר חסר העיניים (eyFLP) 18,19. בדרך זו, שיבוטי GFP שכותרתו נוצרים בשני האפיתל peripodial ואת העמודים של EAD ואת neuroepithelium של המוח בכל שלבים עובריים זחל (איור 1 א ', ב' ו-התייחסות 20). משובטים ניתן בעקבות בקלות עד לבגרות כמו EAD מפתחת לתוך עין המבוגרת, כמוסת האנטנה והראש בעוד neuroepithelium מוליד neuroblasts המייצרים נוירונים באונה אופטיים מובחנים.

כדי להקל על אפיון מולקולרי, פונקציונלי פנוטיפי נרחב של רקמת הפסיפס, אנחנו דהסופר פרוטוקול לנתיחה של EAD והמוח מן זחלי instar השלישיים מתאר כיצד לעבד אותם במשך שלושה יישומים שונים: (i) זיהוי של כתבי ניאון מהונדסים immunostaining, (ii) כימות הפולשנות גידול (iii) ניתוח ביטוי גנים משנה באמצעות כמותי בזמן אמת PCR (qRT-PCR) או רצף mRNA תפוקה גבוהה (mRNA-seq) (תרשים 1C).

פרוטוקול immunostaining יכול לשמש כדי לחזות חלבון כלשהו של עניין עם נוגדן ספציפי. כתבי תעתיק פלורסנט מהונדסים לספק מידע spatiotemporal נוח ומדויק על פעילות מסלול איתות מסוימת. תא שושלת כתבים ספציפיים, ומצד שני, משקפים שינויים איכותיים וכמותיים אוכלוסיות תאים בתוך הרקמה פסיפס ובקרב גידולים של גנוטיפים ברורים. כימות התנהגות פולשנית מקל על השוואה של ממאירות הגידול בין גנוטיפים. לבסוף, פרוטוקול המתאר איסוף ועיבוד של EAD פסיפס עבור בידוד RNA הוא מתאים הן יישומים במורד הזרם קטן בקנה מידה גדול כגון שעתוק לאחור ולאחריו qRT-PCR ו-seq mRNA רחב הגנום, בהתאמה. הנתונים האיכותיים והכמותיים המתקבלים מבחנים אלה מספקים תובנות רומן לתוך ההתנהגות החברתית של גידולים משובטים. יתר על כן, הם מייצרים בסיס איתן ללימודים תפקודיים על עצם את התפקיד של גנים בודדים, רשתות גנטיות microenvironment גידול בשלבים שונים והיבטים של tumorigenesis.

Protocol

הערה: עבודה זו מנצלת את eyFLP1; מעשה> y +> Gal4, כטב"מ- GFP; FRT82B, גיגית-Gal80 MARCM 82B הירוק הבוחן קו 11. חציית בתולות בוחן MARCM 82B הירוקה לזכרים של זנים כגון w; כטב"מ-A; כטב"מ-ב RNAi, גנוטיפ mut ג FRT82B יניב צאצאים שבו רקומבינציה mitotic תתרחש בין הזרועות התקינות ?…

Representative Results

כדי להדגים את הפוטנציאל של טכניקת eyFLP-MARCM ליצור תיקוני מסומן GFP של גנוטיפים שהוגדרו תסיסנית EAD, שלושה סוגים של שיבוטים היו מושרים: (1) GFP להביע בקרה בלבד (2) גידולים ממאירים הבעת טופס שבעור של קטן G- חלבון ראס (ראס V12) ב רקע של אובדן הומוזיגוטים של…

Discussion

הטכניקות כדי ליצור פסיפסים גנטיים תסיסנית הם בין הכלים המתוחכמים ביותר לניתוח וטיפול גן פונקצית 33. מערכת eyFLP-MARCM הוכיחה חזקה ויציבה שכן היא מאפשרת האינדוקציה של מסומן באופן ויזואלי, שיבוטים מוגדרים גנטי באופן מוגבל מרחבית, כלומר, ברקמות שבו משפר חסר…

Declarações

The authors have nothing to disclose.

Acknowledgements

We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

Materials

Agar Gewürzmühle Brecht, Eggenstein, Germany 00262-0500 Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C.
Corn syrup Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany 01939
Propionic acid Carl Roth GmbH, Karlsruhe, Germany 6026.1
Cornmeal ReformKontor GmbH, Zarrentin, Germany 4010155063948
Malt extract CSM Deutschland GmbH, Bremen, Germany 728985
Soy flour Stockmeier Food GmbH, Herford, Germany 1000246441010
Yeast Werner Ramspeck GmbH, Schwabach, Germany 210099K
Methyl-4-benzoate/ Nipagin Sigma-Aldrich, Deisenhofen, Germany H5501 Prepare a 15% stock solution with 70% EtOH
Drosophila fly food vials Kisker Biotech, Steinfurt, Germany 789008
Vial plugs K-TK e.K., Retzstadt, Germany 1002
Drosophila fly food bottles Greiner Bio-One, Frickenhausen, Germany 960177
Bottle plugs K-TK e.K., Retzstadt, Germany 1002 S
Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n Sigma-Aldrich, Deisenhofen, Germany 81381 Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C.
1,4-Diazabicyclo[2.2.2]octane/ DABCO  Sigma-Aldrich, Deisenhofen, Germany D2522
Triton X-100 Sigma-Aldrich, Deisenhofen, Germany 9002-93-1
Phosphate-buffered saline/ PBS 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O
PBST 0.1% Triton X-100 in PBS
Paraformaldehyde/ PFA Sigma-Aldrich, Deisenhofen, Germany 158127 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)
Bovine Serum Albumin/ BSA Sigma-Aldrich, Deisenhofen, Germany A3059 Blocking solution recipe: Dissolve 0.3% BSA in PBST
4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI Carl Roth GmbH, Karlsruhe, Germany 6335 DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST.
Alexa Flour 546 Phalloidin Invitrogen, Karlsruhe, Germany A22283 Used in dilution 1:500 in PBST.
Mouse anti-H2 antibody Kurucz et al., 2003 Used in dilution 1:500 in blocking solution
Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson ImmunoResearch, Suffolk, UK 715-175-151 Used in dilution 1:500 in blocking solution
Dumont #5 forceps Fine Science Tools, Heidelberg, Germany 11295-10
Glass embryo dish (30 mm) Thermo Scientific, Schwerte, Germany E90
Tungsten needles Fine Science Tools, Heidelberg, Germany 10130-20
Nickel Plated Pin Holder Fine Science Tools, Heidelberg, Germany 26018-17
Microscope slides VWR, Darmstadt, Germany 631-1553
Coverslips 22 x 22 mm (#1 Menzel-Gläser) VWR, Darmstadt, Germany 631-1336
Coverslips 24 x 50 mm (0.13-0.16 mm) Thermo Scientific, Schwerte, Germany 1076371
Kimtech Science Precision Wipes Thermo Scientific, Schwerte, Germany 06-677-70
Dissecting stereomicroscope Olympus, Hamburg, Germany SZX7 (DF PLAPO 1X-4 Japan)
Fluorescent stereomicroscope Olympus, Hamburg, Germany SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.
Confocal microscope Olympus, Hamburg, Germany FV1000 Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software
Drosophila cooled incubator Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany  Sanyo MIR553
Squirt bottle VWR, Darmstadt, Germany 215-8105
BD Clay Adams Nutator Mixer VWR, Darmstadt, Germany 15172-203
ELMI Digital Rocking Shaker VWR, Darmstadt, Germany DRS-12
5 PRIME Isol-RNA Lysis Reagent VWR, Darmstadt, Germany 2302700 The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).
Diethyl pyrocarbonate/ DEPC Sigma-Aldrich, Deisenhofen, Germany D5758 Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany 15593-031
Chloroform Merck, Darmstadt, Germany 102445
TURBO DNase (2 U/µl) Thermo Scientific, Schwerte, Germany AM2238
Invitrogen UltraPure Glycogen ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany 10-814-010
Sodium acetate trihydrate VWR, Darmstadt, Germany 27652.232 Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2
2-Propanol Merck, Darmstadt, Germany 109634
Ethanol Merck, Darmstadt, Germany 100983 Prepare a 75% EtOH dilution with DEPC-H2O.
UV/Vis-Spectrophotometre NanoDrop ND-8000 Thermo Scientific, Schwerte, Germany ND-8000
Eppendorf Microcentrifuge (Refrigerated) Thermo Scientific, Schwerte, Germany 5417R
Experion RNA StdSens Analysis Kit Bio-Rad Laboratories GmbH, München, Germany 7007103
Experion Automated Electrophoresis Station Bio-Rad Laboratories GmbH, München, Germany 7007010
SuperScript III Reverse Transcriptase Thermo Scientific, Schwerte, Germany 18080044
Oligo d(T) Primer Integrated DNA Technologies, Leuven, Belgium Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C
dNTP Mixture Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France 4030 Store aliquots of 25 µl at -20°C
CFX96 Touch Real-Time PCR Detection System Bio-Rad Laboratories GmbH, München, Germany 1855195
iQ SYBR Green Supermix Bio-Rad Laboratories GmbH, München, Germany 170-8882
Hard-Shell PCR Plates 96-well, thin wall Bio-Rad Laboratories GmbH, München, Germany HSP9601
Microseal 'B' Film Bio-Rad Laboratories GmbH, München, Germany MSB1001
rp49 Forward primer Integrated DNA Technologies, Leuven, Belgium 5' TCCTACCAGCTTCAAGATGAC 3'
rp49 Reverse primer Integrated DNA Technologies, Leuven, Belgium 5' CACGTTGTGCACCAGGAACT 3'
mmp1 Forward primer Integrated DNA Technologies, Leuven, Belgium 5' AGGGCGACAAGTACTACAAGCTGA 3'
mmp1 Reverse primer Integrated DNA Technologies, Leuven, Belgium 5' ACGTCTTGCCGTTCTTGTAGGTGA 3'
DOWNLOAD MATERIALS LIST

Referências

  1. Miles, W. O., Dyson, N. J., Walker, J. A. Modeling tumor invasion and metastasis in Drosophila. Dis Model Mech. 4 (6), 753-761 (2011).
  2. Stefanatos, R. K. A., Vidal, M. Tumor invasion and metastasis in Drosophila: a bold past, a bright future. J Genet Genomics. 38 (10), 431-438 (2011).
  3. Patel, P. H., Edgar, B. A. Tissue design: How Drosophila tumors remodel their neighborhood. Semin Cell Dev Biol. 28, 86-95 (2014).
  4. Gonzalez, C. Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics. Nat Rev Cancer. 13 (3), 172-183 (2013).
  5. Lee, T., Luo, L. Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development. Trends Neurosci. 24 (5), 251-254 (2001).
  6. Xu, T., Rubin, G. M. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development. 117 (4), 1223-1237 (1993).
  7. Struhl, G., Basler, K. Organizing activity of wingless protein in Drosophila. Cell. 72 (4), 527-540 (1993).
  8. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118 (2), 401-415 (1993).
  9. Wu, J. S., Luo, L. A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila. Nat Protoc. 1 (6), 2583-2589 (2006).
  10. Brumby, A. M., Richardson, H. E. scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila. EMBO J. 22 (21), 5769-5779 (2003).
  11. Pagliarini, R. A., Xu, T. A genetic screen in Drosophila for metastatic behavior. Science (New York, NY). 302 (5648), 1227-1231 (2003).
  12. Uhlirova, M., Bohmann, D. JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J. 25 (22), 5294-5304 (2006).
  13. Turkel, N., et al. The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state. PLoS Genet. 9 (7), e1003627 (2013).
  14. Cordero, J. B., et al. Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter. Dev Cell. 18 (6), 999-1011 (2010).
  15. Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling. Dis Model Mech. 6, 661-678 (2013).
  16. Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling. Oncogene. 30 (29), 3248-3260 (2011).
  17. Figueroa-Clarevega, A., Bilder, D. Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting. Dev Cell. 33 (1), 47-55 (2015).
  18. Newsome, T. P., Asling, B., Dickson, B. J. Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics. Development. 127 (4), 851-860 (2000).
  19. Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans. Science. 265 (5173), 785-789 (1994).
  20. Külshammer, E., Uhlirova, M. The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling. J Cell Sci. 126 (Pt 4), 927-938 (2013).
  21. North, A. J. Seeing is believing? A beginners’ guide to practical pitfalls in image acquisition. J Cell Biol. 172 (1), 9-18 (2006).
  22. Waters, J. C. Accuracy and precision in quantitative fluorescence microscopy. J Cell Biol. 185 (7), 1135-1148 (2009).
  23. Igaki, T., Pagliarini, R. A., Xu, T. Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila. Curr Biol. 16 (11), 1139-1146 (2006).
  24. Külshammer, E., et al. Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy. Dis Model Mech. 8 (10), 1279-1293 (2015).
  25. Pastor-Pareja, J. C., Wu, M., Xu, T. An innate immune response of blood cells to tumors and tissue damage in Drosophila. Dis Model Mech. 1 (2-3), 144-154 (2008).
  26. Chatterjee, N., Bohmann, D. A versatile ΦC31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture. PloS One. 7 (4), e34063 (2012).
  27. Petraki, S., Alexander, B., Brückner, K. Assaying Blood Cell Populations of the Drosophila melanogaster Larva. J Vis Exp. (105), (2015).
  28. Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. The peripheral nervous system supports blood cell homing and survival in the Drosophila larva. Development. 138 (24), 5379-5391 (2011).
  29. Kurucz, E., et al. Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila. Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).
  30. Andersen, D. S., et al. The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth. Nature. 522 (7557), 482-486 (2015).
  31. Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion. Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).
  32. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6 (1), (2005).
  33. Blair, S. S. Genetic mosaic techniques for studying Drosophila development. Development. 130 (21), 5065-5072 (2003).
  34. Mirth, C. K., Shingleton, A. W. Integrating body and organ size in Drosophila: recent advances and outstanding problems. Front Endocrinol. 3 (49), (2012).
  35. French, V., Feast, M., Partridge, L. Body size and cell size in Drosophila: the developmental response to temperature. J Insect Physiol. 44 (11), 1081-1089 (1998).
  36. Ashburner, M., Bonner, J. J. The induction of gene activity in drosophila by heat shock. Cell. 17 (2), 241-254 (1979).
  37. Frazier, M. R., Woods, H. A., Harrison, J. F. Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster. Physiol Biochem Zool. 74 (5), 641-650 (2001).
  38. Lai, S. L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nat Neurosci. 9 (5), 703-709 (2006).
  39. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141 (3), 536-548 (2010).
  40. del Valle Rodrìguez, A., Didiano, D., Desplan, C. Power tools for gene expression and clonal analysis in Drosophila. Nature Methods. 9 (1), 47-55 (2011).
  41. Rynes, J., et al. Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis. Mol Cell Biol. 32 (19), 3949-3962 (2012).
  42. Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing. PLoS Genet. 10 (4), e1004287 (2014).
  43. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). J Vis Exp. (41), (2010).
  44. Tauc, H. M., Tasdogan, A., Pandur, P. Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging. J Vis Exp. (94), (2014).

Tags

DrosophilaImaginal DiscTumor ModelGenetic MosaicsGene ExpressionCell InvasivenessQuantificationFluorescent LabelingMARCMFLP-FRT SystemDissectionImmunostainingImage Analysis
check_url/pt/54585?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citar este artigo
Mundorf, J., Uhlirova, M. The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics. J. Vis. Exp. (116), e54585, doi:10.3791/54585 (2016).
Baixar citação
Reimpressões e Permissões

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image