Il<em> Drosophila</em> Immaginale Disc tumore Modello: visualizzazione e la quantificazione di espressione genica e di Tumor invasività Utilizzando genetica Mosaici
Summary
Questo protocollo dimostra come generare tumori clonali fluorescente segnato, geneticamente definite nei dischi immaginali antennali (EAD) occhio Drosophila /. Esso descrive come sezionare la EAD e il cervello dalla terza larve instar e come elaborarli per visualizzare e quantificare i cambiamenti di espressione genica e l'invasività del tumore.
Abstract
Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.
Introduction
Il cancro rappresenta uno dei gruppi più geneticamente eterogeneo di malattie, la cui incidenza e la mortalità è drammaticamente in aumento, in particolare tra gli anziani in tutto il mondo. Il cancro ha origine clonale da una cellula tumorale-inizio che sfugge meccanismi oncosoppressori intrinseca e divide fuori controllo. Il progressivo accumulo di lesioni genetiche che promuovono in cooperazione la crescita, la proliferazione e la motilità, mentre inibisce la morte e la differenziazione trasforma la crescita eccessiva benigna iniziale in un tumore altamente maligno, metastatico e mortale. È diventato evidente che, oltre ad alterazioni genetiche, progressione tumorale richiede cambiamenti nello stroma circostante e diafonia tra i tipi di tumore e multiple di cellule (ad esempio, fibroblasti, cellule immunitarie e endoteliali) nel suo microambiente. La comprensione dei principi molecolari alla base la trasformazione maligna comprese le interazioni tumore-stroma è di grande importanza per lo sviluppo di prevenzionezione e screening precoce strategie, così come i trattamenti nuovi ed efficaci per combattere la metastasi del cancro e la resistenza ai farmaci.
La mosca della frutta Drosophila melanogaster è diventato un sistema interessante per la ricerca sul cancro 1-4 grazie al suo tempo di generazione veloce, notevole risparmio di segnalazione nodi tra le mosche e gli esseri umani, limitati ridondanza genetica e la ricchezza di strumenti genetici avanzati che facilitano la manipolazione di quasi ogni gene in maniera limitata temporaneamente e spazialmente. Tumori geneticamente definite di varia malignità possono essere riproducibile progettati in Drosophila introducendo GAIN- e la perdita-di-funzione mutazioni in un sottogruppo di progenitori in un tessuto di tipo altrimenti selvaggio con la tecnica MARCM 5. Lo strumento MARCM combina FLP / FRT (FLP ricombinasi / FLP Target Recognition) mediata ricombinazione mitotica 6 con FLP-out 7 e GAL4 / UAS (Upstream sequenza di attivazione) del gene bersaglio 8sistemi di espressione 9. Con questo metodo l'espressione di qualsiasi transgene UAS-based, tra cui oncogene o cDNA proteina fluorescente o ripetizioni di DNA invertite per silenziamento genico dsRNA-indotta, sarà limitato a un clone di cellule che hanno perso uno specifico locus genetico e un repressore GAL4 a causa di ricombinazione (Figura 1A). Patch clonali contrassegnati con verde fluorescente (GFP) o proteine fluorescenti rossi (ad esempio, RFP, DsRed, mCherry) può essere facilmente rintracciato durante lo sviluppo, isolato e analizzato. È importante sottolineare che il loro comportamento può essere direttamente confrontata con l'adiacente tessuti wild type. Così, domande pertinenti alla cella effetti autonome e non autonome di lesioni genetiche possono essere studiati convenientemente. Simile a mammiferi, solo cloni in cui lesioni multiple oncogeni sono combinati diventano maligne in Drosophila e ricapitolano caratteristiche chiave del cancro mammiferi. Essi overproliferate, eludere l'apoptosi, inducono l'infiammazione, diventare immortale e Invasive, in ultima analisi, uccidendo l'ospite 10-17.
Qui, descriviamo un protocollo di generare tumori clonali geneticamente definite nel tessuto oculare / antenne e il cervello di Drosophila larve con la tecnica MARCM. Il metodo si basa su un tester magazzino MARCM che esprime la FLP ricombinasi lievito sotto il controllo del enhancer senza occhi (eyFLP) 18,19. In questo modo, cloni GFP-etichettata sono generati in funzione sia epitelio colonnare peripodial e della EAD e neuroepitelio del cervello durante le fasi embrionali e larvali (Figura 1A, B e di riferimento 20). I cloni possono essere facilmente seguiti fino all'età adulta, come la EAD si sviluppa nella capsula occhio adulti, antenna e la testa mentre il neuroepitelio dà luogo a neuroblasti che producono differenziate neuroni del lobo ottiche.
Per facilitare estesa caratterizzazione molecolare, funzionale e fenotipica del tessuto mosaico, si descrivano un protocollo per la dissezione del EAD e il cervello dalla terza larve instar e delineare come elaborarli per tre diverse applicazioni: (i) la rilevazione di reporter fluorescenti transgenici e immunostaining, (ii) la quantificazione di invasività tumorale e (iii) analisi dei espressione genica cambia utilizzando una quantitativa real-time PCR (qRT-PCR) o di un high-throughput sequencing mRNA (mRNA-seq) (Figura 1C).
Il protocollo immunostaining può essere utilizzato per visualizzare qualsiasi proteina di interesse con un anticorpo specifico. Transgenici reporter trascrizionali fluorescenti forniscono informazioni spazio-temporale comodo e preciso sull'attività di un particolare percorso di segnalazione. reporter specifici Cell-lignaggio, invece, riflettono i cambiamenti qualitativi e quantitativi in popolazioni di cellule all'interno del tessuto del mosaico e tra tumori genotipi distinti. La quantificazione del comportamento invasivo facilita il confronto delle malignità del tumore tra il genotipoS. Infine, il protocollo che descrive la raccolta e l'elaborazione di EAD mosaico per l'isolamento di RNA è adatto sia per applicazioni a valle piccola e grande scala, come trascrizione inversa seguita da rispettivamente qRT-PCR e di tutto il genoma mRNA-Seq,. I dati qualitativi e quantitativi ottenuti da questi test forniscono nuove intuizioni sul comportamento sociale dei tumori clonali. Inoltre, producono una solida base per studi funzionali sul ruolo dei singoli geni, le reti genetiche e microambiente tumorale in diverse fasi e gli aspetti della tumorigenesi.
Protocol
Representative Results
Discussion
Le tecniche per generare mosaici genetici in Drosophila sono tra gli strumenti più sofisticati per l'analisi e la manipolazione di funzione del gene 33. Il sistema eyFLP-MARCM ha dimostrato potente e robusto quanto consente l'induzione di marcate visivamente, cloni geneticamente definiti in modo spazialmente ristretta, cioè, in tessuti dove enhancer eyeless è attivo 9,18. Ciò è particolarmente importante quando più lesioni genetiche sono combinati nelle stes…
Declarações
The authors have nothing to disclose.
Acknowledgements
We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.
Materials
| Agar | Gewürzmühle Brecht, Eggenstein, Germany | 00262-0500 | Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C. |
| Corn syrup | Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany | 01939 | |
| Propionic acid | Carl Roth GmbH, Karlsruhe, Germany | 6026.1 | |
| Cornmeal | ReformKontor GmbH, Zarrentin, Germany | 4010155063948 | |
| Malt extract | CSM Deutschland GmbH, Bremen, Germany | 728985 | |
| Soy flour | Stockmeier Food GmbH, Herford, Germany | 1000246441010 | |
| Yeast | Werner Ramspeck GmbH, Schwabach, Germany | 210099K | |
| Methyl-4-benzoate/ Nipagin | Sigma-Aldrich, Deisenhofen, Germany | H5501 | Prepare a 15% stock solution with 70% EtOH |
| Drosophila fly food vials | Kisker Biotech, Steinfurt, Germany | 789008 | |
| Vial plugs | K-TK e.K., Retzstadt, Germany | 1002 | |
| Drosophila fly food bottles | Greiner Bio-One, Frickenhausen, Germany | 960177 | |
| Bottle plugs | K-TK e.K., Retzstadt, Germany | 1002 S | |
| Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n | Sigma-Aldrich, Deisenhofen, Germany | 81381 | Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C. |
| 1,4-Diazabicyclo[2.2.2]octane/ DABCO | Sigma-Aldrich, Deisenhofen, Germany | D2522 | |
| Triton X-100 | Sigma-Aldrich, Deisenhofen, Germany | 9002-93-1 | |
| Phosphate-buffered saline/ PBS | 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O | ||
| PBST | 0.1% Triton X-100 in PBS | ||
| Paraformaldehyde/ PFA | Sigma-Aldrich, Deisenhofen, Germany | 158127 | 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes) |
| Bovine Serum Albumin/ BSA | Sigma-Aldrich, Deisenhofen, Germany | A3059 | Blocking solution recipe: Dissolve 0.3% BSA in PBST |
| 4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI | Carl Roth GmbH, Karlsruhe, Germany | 6335 | DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST. |
| Alexa Flour 546 Phalloidin | Invitrogen, Karlsruhe, Germany | A22283 | Used in dilution 1:500 in PBST. |
| Mouse anti-H2 antibody | Kurucz et al., 2003 | Used in dilution 1:500 in blocking solution | |
| Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) | Jackson ImmunoResearch, Suffolk, UK | 715-175-151 | Used in dilution 1:500 in blocking solution |
| Dumont #5 forceps | Fine Science Tools, Heidelberg, Germany | 11295-10 | |
| Glass embryo dish (30 mm) | Thermo Scientific, Schwerte, Germany | E90 | |
| Tungsten needles | Fine Science Tools, Heidelberg, Germany | 10130-20 | |
| Nickel Plated Pin Holder | Fine Science Tools, Heidelberg, Germany | 26018-17 | |
| Microscope slides | VWR, Darmstadt, Germany | 631-1553 | |
| Coverslips 22 x 22 mm (#1 Menzel-Gläser) | VWR, Darmstadt, Germany | 631-1336 | |
| Coverslips 24 x 50 mm (0.13-0.16 mm) | Thermo Scientific, Schwerte, Germany | 1076371 | |
| Kimtech Science Precision Wipes | Thermo Scientific, Schwerte, Germany | 06-677-70 | |
| Dissecting stereomicroscope | Olympus, Hamburg, Germany | SZX7 (DF PLAPO 1X-4 Japan) | |
| Fluorescent stereomicroscope | Olympus, Hamburg, Germany | SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera | Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11. |
| Confocal microscope | Olympus, Hamburg, Germany | FV1000 | Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software |
| Drosophila cooled incubator | Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany | Sanyo MIR553 | |
| Squirt bottle | VWR, Darmstadt, Germany | 215-8105 | |
| BD Clay Adams Nutator Mixer | VWR, Darmstadt, Germany | 15172-203 | |
| ELMI Digital Rocking Shaker | VWR, Darmstadt, Germany | DRS-12 | |
| 5 PRIME Isol-RNA Lysis Reagent | VWR, Darmstadt, Germany | 2302700 | The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596). |
| Diethyl pyrocarbonate/ DEPC | Sigma-Aldrich, Deisenhofen, Germany | D5758 | Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave. |
| UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 15593-031 | |
| Chloroform | Merck, Darmstadt, Germany | 102445 | |
| TURBO DNase (2 U/µl) | Thermo Scientific, Schwerte, Germany | AM2238 | |
| Invitrogen UltraPure Glycogen | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 10-814-010 | |
| Sodium acetate trihydrate | VWR, Darmstadt, Germany | 27652.232 | Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2 |
| 2-Propanol | Merck, Darmstadt, Germany | 109634 | |
| Ethanol | Merck, Darmstadt, Germany | 100983 | Prepare a 75% EtOH dilution with DEPC-H2O. |
| UV/Vis-Spectrophotometre NanoDrop ND-8000 | Thermo Scientific, Schwerte, Germany | ND-8000 | |
| Eppendorf Microcentrifuge (Refrigerated) | Thermo Scientific, Schwerte, Germany | 5417R | |
| Experion RNA StdSens Analysis Kit | Bio-Rad Laboratories GmbH, München, Germany | 7007103 | |
| Experion Automated Electrophoresis Station | Bio-Rad Laboratories GmbH, München, Germany | 7007010 | |
| SuperScript III Reverse Transcriptase | Thermo Scientific, Schwerte, Germany | 18080044 | |
| Oligo d(T) Primer | Integrated DNA Technologies, Leuven, Belgium | Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C | |
| dNTP Mixture | Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France | 4030 | Store aliquots of 25 µl at -20°C |
| CFX96 Touch Real-Time PCR Detection System | Bio-Rad Laboratories GmbH, München, Germany | 1855195 | |
| iQ SYBR Green Supermix | Bio-Rad Laboratories GmbH, München, Germany | 170-8882 | |
| Hard-Shell PCR Plates 96-well, thin wall | Bio-Rad Laboratories GmbH, München, Germany | HSP9601 | |
| Microseal 'B' Film | Bio-Rad Laboratories GmbH, München, Germany | MSB1001 | |
| rp49 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' TCCTACCAGCTTCAAGATGAC 3' | |
| rp49 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' CACGTTGTGCACCAGGAACT 3' | |
| mmp1 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' AGGGCGACAAGTACTACAAGCTGA 3' | |
| mmp1 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' ACGTCTTGCCGTTCTTGTAGGTGA 3' |
Referências
- Miles, W. O., Dyson, N. J., Walker, J. A. Modeling tumor invasion and metastasis in Drosophila. Dis Model Mech. 4 (6), 753-761 (2011).
- Stefanatos, R. K. A., Vidal, M. Tumor invasion and metastasis in Drosophila: a bold past, a bright future. J Genet Genomics. 38 (10), 431-438 (2011).
- Patel, P. H., Edgar, B. A. Tissue design: How Drosophila tumors remodel their neighborhood. Semin Cell Dev Biol. 28, 86-95 (2014).
- Gonzalez, C. Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics. Nat Rev Cancer. 13 (3), 172-183 (2013).
- Lee, T., Luo, L. Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development. Trends Neurosci. 24 (5), 251-254 (2001).
- Xu, T., Rubin, G. M. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development. 117 (4), 1223-1237 (1993).
- Struhl, G., Basler, K. Organizing activity of wingless protein in Drosophila. Cell. 72 (4), 527-540 (1993).
- Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118 (2), 401-415 (1993).
- Wu, J. S., Luo, L. A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila. Nat Protoc. 1 (6), 2583-2589 (2006).
- Brumby, A. M., Richardson, H. E. scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila. EMBO J. 22 (21), 5769-5779 (2003).
- Pagliarini, R. A., Xu, T. A genetic screen in Drosophila for metastatic behavior. Science (New York, NY). 302 (5648), 1227-1231 (2003).
- Uhlirova, M., Bohmann, D. JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J. 25 (22), 5294-5304 (2006).
- Turkel, N., et al. The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state. PLoS Genet. 9 (7), e1003627 (2013).
- Cordero, J. B., et al. Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter. Dev Cell. 18 (6), 999-1011 (2010).
- Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling. Dis Model Mech. 6, 661-678 (2013).
- Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling. Oncogene. 30 (29), 3248-3260 (2011).
- Figueroa-Clarevega, A., Bilder, D. Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting. Dev Cell. 33 (1), 47-55 (2015).
- Newsome, T. P., Asling, B., Dickson, B. J. Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics. Development. 127 (4), 851-860 (2000).
- Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans. Science. 265 (5173), 785-789 (1994).
- Külshammer, E., Uhlirova, M. The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling. J Cell Sci. 126 (Pt 4), 927-938 (2013).
- North, A. J. Seeing is believing? A beginners’ guide to practical pitfalls in image acquisition. J Cell Biol. 172 (1), 9-18 (2006).
- Waters, J. C. Accuracy and precision in quantitative fluorescence microscopy. J Cell Biol. 185 (7), 1135-1148 (2009).
- Igaki, T., Pagliarini, R. A., Xu, T. Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila. Curr Biol. 16 (11), 1139-1146 (2006).
- Külshammer, E., et al. Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy. Dis Model Mech. 8 (10), 1279-1293 (2015).
- Pastor-Pareja, J. C., Wu, M., Xu, T. An innate immune response of blood cells to tumors and tissue damage in Drosophila. Dis Model Mech. 1 (2-3), 144-154 (2008).
- Chatterjee, N., Bohmann, D. A versatile ΦC31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture. PloS One. 7 (4), e34063 (2012).
- Petraki, S., Alexander, B., Brückner, K. Assaying Blood Cell Populations of the Drosophila melanogaster Larva. J Vis Exp. (105), (2015).
- Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. The peripheral nervous system supports blood cell homing and survival in the Drosophila larva. Development. 138 (24), 5379-5391 (2011).
- Kurucz, E., et al. Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila. Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).
- Andersen, D. S., et al. The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth. Nature. 522 (7557), 482-486 (2015).
- Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion. Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).
- Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6 (1), (2005).
- Blair, S. S. Genetic mosaic techniques for studying Drosophila development. Development. 130 (21), 5065-5072 (2003).
- Mirth, C. K., Shingleton, A. W. Integrating body and organ size in Drosophila: recent advances and outstanding problems. Front Endocrinol. 3 (49), (2012).
- French, V., Feast, M., Partridge, L. Body size and cell size in Drosophila: the developmental response to temperature. J Insect Physiol. 44 (11), 1081-1089 (1998).
- Ashburner, M., Bonner, J. J. The induction of gene activity in drosophila by heat shock. Cell. 17 (2), 241-254 (1979).
- Frazier, M. R., Woods, H. A., Harrison, J. F. Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster. Physiol Biochem Zool. 74 (5), 641-650 (2001).
- Lai, S. L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nat Neurosci. 9 (5), 703-709 (2006).
- Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141 (3), 536-548 (2010).
- del Valle Rodrìguez, A., Didiano, D., Desplan, C. Power tools for gene expression and clonal analysis in Drosophila. Nature Methods. 9 (1), 47-55 (2011).
- Rynes, J., et al. Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis. Mol Cell Biol. 32 (19), 3949-3962 (2012).
- Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing. PLoS Genet. 10 (4), e1004287 (2014).
- Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). J Vis Exp. (41), (2010).
- Tauc, H. M., Tasdogan, A., Pandur, P. Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging. J Vis Exp. (94), (2014).
