Summary

<em> Drosophila</em> Hayali Disk Tümör Modeli: Genetik Mozaikler kullanma Gen İfade ve Tümör invazivliğinin Görselleştirme ve

Published: October 06, 2016
doi:

Summary

Bu protokol Drosophila göz / antennal hayali diskleri (EAD) floresan işaretli, genetik olarak tanımlanmış klonal tümörleri oluşturmak için nasıl gösterir. Üçüncü evre larvaları ve nasıl görselleştirmek ve gen ifadesi değişikliklerini ve tümör yayılmasını ölçmek için bunları işlemek için EAD ve beyin teşrih açıklamaktadır.

Abstract

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

Introduction

Kanser insidans ve mortalite önemli ölçüde dünya çapında, özellikle yaşlılarda, artan hastalıkların en genetik olarak heterojen bir grup, birini temsil eder. Kanser doğasında tümör baskılayıcı mekanizmalarını kaçar ve kontrol dışı bölen bir tümör başlatan hücre klonal kaynaklanır. ölüm ve farklılaşmasını inhibe ederken işbirliği büyüme, çoğalma ve motilitesini teşvik genetik lezyonların kademeli birikimi yüksek, malign metastatik ve ölümcül tümör içine ilk selim üremesine dönüştürür. Bu genetik değişikliklerin yanı sıra, tümör ilerlemesi olan mikro-tümör ve çok sayıda hücre türleri (örneğin, fibroblastlar, immün ve endotel hücreleri) arasındaki çevre stroma ve çapraz-karışma değişiklik gerektiren belirgin hale gelmiştir. tümör stroma etkileşimleri de dahil olmak üzere malign transformasyon altında yatan moleküler ilkelerinin anlaşılması PREVEN geliştirmek için büyük önem taşıyoryon ve erken tarama stratejilerinin yanı sıra, yeni ve etkili tedavi, kanser metastazı ve ilaç direncine karşı koymak.

Meyve sineği Drosophila Melanogaster'in onun hızlı nesil zaman nedeniyle kanser araştırmaları 1-4 için çekici bir sistem haline gelmiştir sinekler ve insanlarda, hemen hemen herhangi bir genin işlenmesini kolaylaştıran gelişmiş genetik araçları sınırlı genetik yedekleme ve zenginlik arasındaki düğümleri sinyal olağanüstü koruma bir geçici ve mekansal kısıtlı bir şekilde. Değişen malignite genetik olarak tanımlanmış tümörler tekrarlanabilir MARCM tekniği 5 kullanan bir başka vahşi tip dokusunda progenitörlerin bir alt kümesi gain- ve zarar-fonksiyon mutasyonlar tanıtarak Drosophila tasarlanmış olabilir. MARCM aracı FLP / FRT (FLP rekombinaz / FLP Tanıma Hedef) FLP-out 7 ve Gal4 / UAS (yukarı aktivasyon dizisi) 8 hedef geni ile mitoz rekombinasyon 6 aracılı birleştiririfade sistemleri 9. dsRNA'nın indüklenen gen susturma onkogen ya da floresan proteini cDNA ya ters çevrilmiş DNA Tekrarlar dahil olmak üzere herhangi UAS göre transgenin bu yöntem ifade ile, spesifik bir genetik yeri ve rekombinasyon nedeniyle bir GAL4 represörü kaybetmiş bir hücre klonu ile sınırlı olacak (Şekil 1A). Klon yamalar yeşil floresan (GFP) veya kırmızı floresan proteinleri ile işaretlenmiş (örneğin, RFP, DsRed, mCherry) kolayca geliştirme, izole ve analiz boyunca izlenebilir. Önemli olarak, onların davranışları doğrudan bitişik vahşi tip dokuya karşılaştırılabilir. Böylece, sorular genetik lezyonların özerk ve özerk olmayan etkiler rahatlıkla ele alınabilir hücreye formüller verilmiştir. Memelilere benzer şekilde, sadece klonları olan çoklu onkojenik lezyonlar Drosophila malign olmak ve memeli kanser kilit işaretlerinden özetlemek kombine edilir. Onlar, apoptoz kaçmasına enflamasyon neden, ölümsüz ve InvAn haline overproliferatesive, sonuçta ev sahibi 10-17 öldürme.

Burada, bir protokol MARCM tekniği kullanılarak Drosophila larvalarının göz / anten ve beyin dokusunda genetik olarak tanımlanmış klonal tümörler oluşturmak için tarif etmektedir. Yöntem, eyeless arttırıcı (eyFLP) 18,19 kontrolü altında maya FLP yeniden bağlayıcı ifade eden bir MARCM test hisse senetleri dayanır. Bu şekilde, GFP etiketli klonlar peripodial ve kolumnar EAD epiteli ve embriyonik ve larva aşamaları (Şekil 1A, B ve referans 20) boyunca beynin neuroepithelium hem de oluşturulur. neuroepithelium farklılaştırılmış optik lob nöronlar üreten neuroblasts doğurmaktadır EAD yetişkin göz, anten ve baş kapsül içine geliştikçe klonlar kolayca yetişkinliğe kadar takip edilebilir.

Biz de mozaik doku geniş, moleküler fonksiyonel ve fenotipik karakterizasyonu kolaylaştırmak içinçubuk üçüncü instar larvaları EAD ve beyin diseksiyon için bir protokol ve üç farklı uygulamalar için işleme nasıl özetlemektedir: (i) transgenik flüoresan muhabir ve immün saptanması, tümör yayılımı ve (iii) analizi, (ii) ölçümü gen ekspresyon kantitatif gerçek zamanlı PCR (qRT-PCR) veya yüksek verimli bir mRNA sıralaması (mRNA DİZİ) (Şekil 1C) ile değiştirir.

immün protokolü spesifik bir antikor ile çıkar proteini görselleştirmek için kullanılabilmektedir. Transgenik floresan transkripsiyonel gazetecilere belirli bir sinyal yolunun aktivitesi üzerine uygun ve kesin uzaysal bilgi sağlar. Hücre soyu, belirli muhabir, diğer taraftan, mozaik doku içinde ve farklı genotipler tümörleri arasında hücre popülasyonlarının niteliksel ve niceliksel değişiklikler göstermektedir. invaziv davranış miktarının belirlenmesi genotipi arasındaki tümör malignite karşılaştırılmasını kolaylaştırırs. Son olarak, RNA izolasyonu için mozaik EAD toplanması ve işlenmesi tarif protokolü, sırasıyla QRT-PCR ve genom mRNA SEQ, ardından ters transkripsiyon hem küçük hem de büyük ölçekli alt uygulama için uygundur. Bu analizler sonucu elde edilen nitel ve nicel veriler klonal tümörlerin sosyal davranış içine yeni bakış açıları sağlayacaktır. Ayrıca, bireysel genler, genetik ağları ve farklı aşamalarında tümör mikro ve tümörogenez yönleriyle rolü üzerine fonksiyonel çalışmalar için sağlam bir temel oluşturur.

Protocol

NOT: Bu çalışma eyFLP1 kullanır; hareket> y +> Gal4, UAS-GFP; FRT82B, küvet-GAL80 MARCM 82B Yeşil test hattı 11. Böyle w suşların erkeklere MARCM 82B Yeşil test bakireler Geçiş; UAS-a; UAS-b RNAi, FRT82B c mut genotip mitotik rekombinasyon 3. homolog kromozomların doğru kolları arasında oluşacak olan soy verecektir. Bu şekilde, FRT82B sitesine uzak bulunan gen c klonlar homozigot mutant EAD ve beyin neuroepithelium içinde olu…

Representative Results

Drosophila EAD tanımlanan genotiplerin GFP işaretlenmiş yamalar oluşturmak için eyFLP-MARCM tekniğin potansiyel göstermek için, klon üç tip indüklenmiştir: Sadece (1) kontrol GFP ifade, (2) habis tümörler, küçük bir onkojenik biçimi eksprese bir tümör baskılayıcı geni Scribbles'ın homozigot kaybı (Scrib 1) 'in bir arka G-proteini Ras (RAS V12), ve (3) büyümeye devam fakat non-invazif ras V12</sup…

Discussion

Teknikler Drosophila genetik mozaikler analiz ve gen fonksiyonu 33 işlemek için en gelişmiş araçlar arasında yer almaktadır oluşturmak için. O gözsüz arttırıcı aktif 9,18 olan dokularda, yani mekansal kısıtlı bir şekilde görsel olarak işaretlenmiş, genetik olarak tanımlanmış klonların indüksiyon izin verdiği eyFLP-MARCM sistemi güçlü ve sağlam olduğunu kanıtlamıştır. Birden çok genetik lezyonlar aynı hücrelerde birleştirilir, bu öz…

Declarações

The authors have nothing to disclose.

Acknowledgements

We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

Materials

Agar Gewürzmühle Brecht, Eggenstein, Germany 00262-0500 Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C.
Corn syrup Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany 01939
Propionic acid Carl Roth GmbH, Karlsruhe, Germany 6026.1
Cornmeal ReformKontor GmbH, Zarrentin, Germany 4010155063948
Malt extract CSM Deutschland GmbH, Bremen, Germany 728985
Soy flour Stockmeier Food GmbH, Herford, Germany 1000246441010
Yeast Werner Ramspeck GmbH, Schwabach, Germany 210099K
Methyl-4-benzoate/ Nipagin Sigma-Aldrich, Deisenhofen, Germany H5501 Prepare a 15% stock solution with 70% EtOH
Drosophila fly food vials Kisker Biotech, Steinfurt, Germany 789008
Vial plugs K-TK e.K., Retzstadt, Germany 1002
Drosophila fly food bottles Greiner Bio-One, Frickenhausen, Germany 960177
Bottle plugs K-TK e.K., Retzstadt, Germany 1002 S
Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n Sigma-Aldrich, Deisenhofen, Germany 81381 Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C.
1,4-Diazabicyclo[2.2.2]octane/ DABCO  Sigma-Aldrich, Deisenhofen, Germany D2522
Triton X-100 Sigma-Aldrich, Deisenhofen, Germany 9002-93-1
Phosphate-buffered saline/ PBS 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O
PBST 0.1% Triton X-100 in PBS
Paraformaldehyde/ PFA Sigma-Aldrich, Deisenhofen, Germany 158127 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)
Bovine Serum Albumin/ BSA Sigma-Aldrich, Deisenhofen, Germany A3059 Blocking solution recipe: Dissolve 0.3% BSA in PBST
4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI Carl Roth GmbH, Karlsruhe, Germany 6335 DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST.
Alexa Flour 546 Phalloidin Invitrogen, Karlsruhe, Germany A22283 Used in dilution 1:500 in PBST.
Mouse anti-H2 antibody Kurucz et al., 2003 Used in dilution 1:500 in blocking solution
Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson ImmunoResearch, Suffolk, UK 715-175-151 Used in dilution 1:500 in blocking solution
Dumont #5 forceps Fine Science Tools, Heidelberg, Germany 11295-10
Glass embryo dish (30 mm) Thermo Scientific, Schwerte, Germany E90
Tungsten needles Fine Science Tools, Heidelberg, Germany 10130-20
Nickel Plated Pin Holder Fine Science Tools, Heidelberg, Germany 26018-17
Microscope slides VWR, Darmstadt, Germany 631-1553
Coverslips 22 x 22 mm (#1 Menzel-Gläser) VWR, Darmstadt, Germany 631-1336
Coverslips 24 x 50 mm (0.13-0.16 mm) Thermo Scientific, Schwerte, Germany 1076371
Kimtech Science Precision Wipes Thermo Scientific, Schwerte, Germany 06-677-70
Dissecting stereomicroscope Olympus, Hamburg, Germany SZX7 (DF PLAPO 1X-4 Japan)
Fluorescent stereomicroscope Olympus, Hamburg, Germany SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.
Confocal microscope Olympus, Hamburg, Germany FV1000 Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software
Drosophila cooled incubator Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany  Sanyo MIR553
Squirt bottle VWR, Darmstadt, Germany 215-8105
BD Clay Adams Nutator Mixer VWR, Darmstadt, Germany 15172-203
ELMI Digital Rocking Shaker VWR, Darmstadt, Germany DRS-12
5 PRIME Isol-RNA Lysis Reagent VWR, Darmstadt, Germany 2302700 The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).
Diethyl pyrocarbonate/ DEPC Sigma-Aldrich, Deisenhofen, Germany D5758 Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany 15593-031
Chloroform Merck, Darmstadt, Germany 102445
TURBO DNase (2 U/µl) Thermo Scientific, Schwerte, Germany AM2238
Invitrogen UltraPure Glycogen ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany 10-814-010
Sodium acetate trihydrate VWR, Darmstadt, Germany 27652.232 Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2
2-Propanol Merck, Darmstadt, Germany 109634
Ethanol Merck, Darmstadt, Germany 100983 Prepare a 75% EtOH dilution with DEPC-H2O.
UV/Vis-Spectrophotometre NanoDrop ND-8000 Thermo Scientific, Schwerte, Germany ND-8000
Eppendorf Microcentrifuge (Refrigerated) Thermo Scientific, Schwerte, Germany 5417R
Experion RNA StdSens Analysis Kit Bio-Rad Laboratories GmbH, München, Germany 7007103
Experion Automated Electrophoresis Station Bio-Rad Laboratories GmbH, München, Germany 7007010
SuperScript III Reverse Transcriptase Thermo Scientific, Schwerte, Germany 18080044
Oligo d(T) Primer Integrated DNA Technologies, Leuven, Belgium Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C
dNTP Mixture Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France 4030 Store aliquots of 25 µl at -20°C
CFX96 Touch Real-Time PCR Detection System Bio-Rad Laboratories GmbH, München, Germany 1855195
iQ SYBR Green Supermix Bio-Rad Laboratories GmbH, München, Germany 170-8882
Hard-Shell PCR Plates 96-well, thin wall Bio-Rad Laboratories GmbH, München, Germany HSP9601
Microseal 'B' Film Bio-Rad Laboratories GmbH, München, Germany MSB1001
rp49 Forward primer Integrated DNA Technologies, Leuven, Belgium 5' TCCTACCAGCTTCAAGATGAC 3'
rp49 Reverse primer Integrated DNA Technologies, Leuven, Belgium 5' CACGTTGTGCACCAGGAACT 3'
mmp1 Forward primer Integrated DNA Technologies, Leuven, Belgium 5' AGGGCGACAAGTACTACAAGCTGA 3'
mmp1 Reverse primer Integrated DNA Technologies, Leuven, Belgium 5' ACGTCTTGCCGTTCTTGTAGGTGA 3'

Referências

  1. Miles, W. O., Dyson, N. J., Walker, J. A. Modeling tumor invasion and metastasis in Drosophila. Dis Model Mech. 4 (6), 753-761 (2011).
  2. Stefanatos, R. K. A., Vidal, M. Tumor invasion and metastasis in Drosophila: a bold past, a bright future. J Genet Genomics. 38 (10), 431-438 (2011).
  3. Patel, P. H., Edgar, B. A. Tissue design: How Drosophila tumors remodel their neighborhood. Semin Cell Dev Biol. 28, 86-95 (2014).
  4. Gonzalez, C. Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics. Nat Rev Cancer. 13 (3), 172-183 (2013).
  5. Lee, T., Luo, L. Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development. Trends Neurosci. 24 (5), 251-254 (2001).
  6. Xu, T., Rubin, G. M. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development. 117 (4), 1223-1237 (1993).
  7. Struhl, G., Basler, K. Organizing activity of wingless protein in Drosophila. Cell. 72 (4), 527-540 (1993).
  8. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118 (2), 401-415 (1993).
  9. Wu, J. S., Luo, L. A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila. Nat Protoc. 1 (6), 2583-2589 (2006).
  10. Brumby, A. M., Richardson, H. E. scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila. EMBO J. 22 (21), 5769-5779 (2003).
  11. Pagliarini, R. A., Xu, T. A genetic screen in Drosophila for metastatic behavior. Science (New York, NY). 302 (5648), 1227-1231 (2003).
  12. Uhlirova, M., Bohmann, D. JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J. 25 (22), 5294-5304 (2006).
  13. Turkel, N., et al. The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state. PLoS Genet. 9 (7), e1003627 (2013).
  14. Cordero, J. B., et al. Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter. Dev Cell. 18 (6), 999-1011 (2010).
  15. Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling. Dis Model Mech. 6, 661-678 (2013).
  16. Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling. Oncogene. 30 (29), 3248-3260 (2011).
  17. Figueroa-Clarevega, A., Bilder, D. Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting. Dev Cell. 33 (1), 47-55 (2015).
  18. Newsome, T. P., Asling, B., Dickson, B. J. Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics. Development. 127 (4), 851-860 (2000).
  19. Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans. Science. 265 (5173), 785-789 (1994).
  20. Külshammer, E., Uhlirova, M. The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling. J Cell Sci. 126 (Pt 4), 927-938 (2013).
  21. North, A. J. Seeing is believing? A beginners’ guide to practical pitfalls in image acquisition. J Cell Biol. 172 (1), 9-18 (2006).
  22. Waters, J. C. Accuracy and precision in quantitative fluorescence microscopy. J Cell Biol. 185 (7), 1135-1148 (2009).
  23. Igaki, T., Pagliarini, R. A., Xu, T. Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila. Curr Biol. 16 (11), 1139-1146 (2006).
  24. Külshammer, E., et al. Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy. Dis Model Mech. 8 (10), 1279-1293 (2015).
  25. Pastor-Pareja, J. C., Wu, M., Xu, T. An innate immune response of blood cells to tumors and tissue damage in Drosophila. Dis Model Mech. 1 (2-3), 144-154 (2008).
  26. Chatterjee, N., Bohmann, D. A versatile ΦC31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture. PloS One. 7 (4), e34063 (2012).
  27. Petraki, S., Alexander, B., Brückner, K. Assaying Blood Cell Populations of the Drosophila melanogaster Larva. J Vis Exp. (105), (2015).
  28. Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. The peripheral nervous system supports blood cell homing and survival in the Drosophila larva. Development. 138 (24), 5379-5391 (2011).
  29. Kurucz, E., et al. Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila. Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).
  30. Andersen, D. S., et al. The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth. Nature. 522 (7557), 482-486 (2015).
  31. Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion. Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).
  32. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6 (1), (2005).
  33. Blair, S. S. Genetic mosaic techniques for studying Drosophila development. Development. 130 (21), 5065-5072 (2003).
  34. Mirth, C. K., Shingleton, A. W. Integrating body and organ size in Drosophila: recent advances and outstanding problems. Front Endocrinol. 3 (49), (2012).
  35. French, V., Feast, M., Partridge, L. Body size and cell size in Drosophila: the developmental response to temperature. J Insect Physiol. 44 (11), 1081-1089 (1998).
  36. Ashburner, M., Bonner, J. J. The induction of gene activity in drosophila by heat shock. Cell. 17 (2), 241-254 (1979).
  37. Frazier, M. R., Woods, H. A., Harrison, J. F. Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster. Physiol Biochem Zool. 74 (5), 641-650 (2001).
  38. Lai, S. L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nat Neurosci. 9 (5), 703-709 (2006).
  39. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141 (3), 536-548 (2010).
  40. del Valle Rodrìguez, A., Didiano, D., Desplan, C. Power tools for gene expression and clonal analysis in Drosophila. Nature Methods. 9 (1), 47-55 (2011).
  41. Rynes, J., et al. Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis. Mol Cell Biol. 32 (19), 3949-3962 (2012).
  42. Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing. PLoS Genet. 10 (4), e1004287 (2014).
  43. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). J Vis Exp. (41), (2010).
  44. Tauc, H. M., Tasdogan, A., Pandur, P. Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging. J Vis Exp. (94), (2014).
check_url/pt/54585?article_type=t

Play Video

Citar este artigo
Mundorf, J., Uhlirova, M. The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics. J. Vis. Exp. (116), e54585, doi:10.3791/54585 (2016).

View Video