préparation et<em> In vitro</em> Caractérisation des aimanté miR-modifié cellules endothéliales
Summary
Ce manuscrit décrit l'efficacité, la livraison non virale de miR aux cellules endothéliales par un vecteur PEI / MNP et leur aimantation. Ainsi, en plus de la modification génétique, cette approche permet d'orientation magnétique des cellules et l'IRM détectabilité. La technique peut être utilisée pour améliorer les caractéristiques des produits thérapeutiques cellulaires.
Abstract
À ce jour, les traitements chirurgicaux et pharmacologiques disponibles pour les maladies cardiovasculaires (MCV) sont limitées et souvent palliative. En même temps, les thérapies géniques et cellulaires sont des approches alternatives très prometteuses pour le traitement des maladies cardiovasculaires. Cependant, la large application clinique de la thérapie génique est fortement limitée par l'absence de systèmes de délivrance de gènes appropriés. Le développement des vecteurs de transfert de gènes appropriés peut fournir une solution aux défis actuels en thérapie cellulaire. En particulier, les inconvénients existants, tels que l' efficacité limitée et une faible rétention cellulaire dans l'organe blessé, pourrait être surmontée par l' ingénierie cellulaire appropriée (c. -à- génétique) avant la transplantation. Le protocole présenté décrit la modification transitoire efficace et sûr des cellules endotheliales en utilisant une nanoparticule magnétique superparamagnétique polyéthylèneimine (PEI / MNP) de vecteur de délivrance à base de. En outre, l'algorithme et les méthodes de caractérisation des cellules sont définies. Le succès intracellulivraison lar de microARN (miR) dans les cellules endothéliales de la veine ombilicale humaine (HUVEC) a été atteint sans affecter la viabilité des cellules, la fonctionnalité ou la communication intercellulaire. De plus, cette approche a été prouvée pour provoquer un effet fonctionnel dans miR de exogène introduite. Fait important, l'application de ce vecteur à base de MNP assure aimantation cellulaire, offrant des possibilités de ciblage magnétique et le suivi IRM non-invasive. Cela peut servir de base à guidés magnétiquement, de la thérapeutique de cellules génétiquement modifiées qui peuvent être contrôlés de façon non invasive avec l'IRM.
Introduction
Thérapie génique et cellulaire sont des outils puissants qui ont le potentiel pour résoudre les défis actuels dans le traitement CVD. Malgré le fait que ces deux approches sont actuellement testées dans les essais cliniques, ils ne sont pas encore prêts pour l' application clinique large 1. En particulier, une approche commune pour faire face aux défis de la thérapie génique et cellulaire est de développer des vecteurs de transfert de gènes multifonctionnels appropriés pour l'application clinique. L'absence de systèmes d'administration de gènes sûrs et efficaces est la principale préoccupation de la thérapie génique. En même temps, le génie génétique des produits cellulaires avant la transplantation pourrait surmonter les graves défis de la thérapie cellulaire, tels que la faible efficacité (par exemple, dans le domaine cardiaque, seulement ~ 5% d'amélioration fonctionnelle est réalisée une transplantation de cellules post-tige 1 ) et une mauvaise rétention / au greffe site de la lésion (c. -à- rétention cellulaire tombe en dessous de 5 – 10% en quelques minutes à quelques heures post application, quelle que soit la voie d'administration 2, 3, 4).
À ce jour, les vecteurs viraux dépassent largement les systèmes non viraux en termes d'efficacité, ce qui a donné lieu à une plus large application dans les essais cliniques (~ 67%) 5. Toutefois, les véhicules viraux comportent des risques graves, telles que l' immunogénicité (et la réponse inflammatoire subséquente, avec des complications graves), l' oncogénicité et les limites de la taille du matériel génétique porté 6. En raison de ces problèmes de sécurité et les coûts élevés de production de vecteurs viraux, l'utilisation de systèmes non viraux est préférable dans certains cas , 7, 8. Il est particulièrement adapté pour des troubles qui nécessitent une correction génétique transitoire, tels que l'expression de facteurs de croissance qui contrôlent l' angiogenèse (par exemple, pour le traitement CVD) ou la delivery des vaccins.
Dans notre groupe, un système de délivrance a été conçue en combinant ramifié de 25 kDa de la polyéthylèneimine (PEI) et de nanoparticules superparamagnétiques d'oxyde de fer (MNP) liés ensemble par une interaction biotine-streptavidine 9. Ce vecteur est un outil potentiel pour le génie génétique des cellules, ce qui permet de leur aimantation simultanée avant la transplantation. Ce dernier constitue une base pour le guidage magnétique / rétention, ce qui est particulièrement prometteuse de nos jours, comme les techniques de ciblage magnétique avancées sont en cours d' élaboration avec succès 10. En outre, les cellules résultantes magnétiquement sensibles sont susceptibles d'être contrôlés de manière non invasive par imagerie par résonance magnétique (IRM) ou l' imagerie de particules magnétiques 11, 12.
Dans le cas du vecteur PEI / MNP, polyamine assure la condensation de l'acide nucléique et ainsi la protection de facteur dégradant s, intériorisation de vecteur dans les cellules, et endosomes échapper 5. Les MNP complètent les propriétés de PEI, non seulement en termes de guidage magnétique, mais aussi en réduisant la toxicité connue PEI 7, 13, 14. Auparavant, les propriétés vectorielles PEI / MNP ont été ajustés en termes d'efficacité d'administration ( à savoir, ADNp et miARN) et de la sécurité en utilisant des fibroblastes et des cellules souches mésenchymateuses humaines 15, 16.
Dans ce manuscrit, un protocole détaillé sur l'application de PEI / MNP pour la génération de cellules modifiées miRNA-17 est décrite. A cet effet, les HUVEC sont utilisés et représentent un modèle établi pour l' angiogenèse in vitro. Ils sont difficiles à transfecter et sont sensibles à l' influence toxique 18, 19,ass = "xref"> 20. De plus, nous fournissons un algorithme pour évaluer ces cellules in vitro, y compris leur ciblage, la communication intercellulaire, et la détection IRM.
Protocol
Representative Results
Discussion
La production de cellules génétiquement modifiées chargées de nanoparticules superparamagnétiques pour leur orientations supplémentaires à commande magnétique est présentée dans le protocole actuel. L'application réussie de cette stratégie permet la résolution de certaines difficultés de la thérapie cellulaire, comme une faible rétention et pauvres dans la région prise de greffe blessés 2, 3, 4, en fournis…
Declarações
The authors have nothing to disclose.
Acknowledgements
Nous tenons à remercier G. Fulda (Electron Microscopy Center, Université de Rostock, Allemagne) pour le soutien technique à l'acquisition d'images TEM de nanoparticules superparamagnétiques filtrées et à effectuer leur analyse aux rayons X. Les travaux effectués au RTC Rostock a été soutenu par le Ministère fédéral de l'éducation et de la recherche en Allemagne (FKZ 0312138A, FKZ 316159 et VIP + 03VP00241) et l'État Mecklembourg-Poméranie occidentale avec les Fonds structurels de l'UE (FSE / IV-WM-B34- 0030/10 et FSE / IV-BM-B35-0010 / 12) et par le DFG (DA 1296-1), le Damp-Foundation, et la base de coeur allemand (F / 01/12). Frank Wiekhorst a été soutenu par le programme de recherche de l'UE 7e PC "Nanomag" FP7-NMP-2013-GRAND-7.
Materials
| PEI 25 kDa | Sigma Aldrich | 408727 | |
| EZ-Link Sulfo-NHS-LC-Biotin | Thermo Scientific | 21335 | |
| PD-10 Desalting Columns | GE Healthcare | 17085101 | Containing Sephadex G-25 Medium |
| Ninhydrin Reagent solution 2% | Sigma Aldrich | 7285 | |
| Glycine | Sigma Aldrich | 410225 | |
| Pierce Biotin Quantitation Kit | Thermo Scientific | 28005 | |
| Microplate reader Model 680 | Bio-Rad | ||
| Streptavidin MagneSphere Paramagnetic Particles | Promega | Z5481 | |
| Millex-HV PVDF Filter | Merck | SLHV013SL | 0.45µm |
| Libra 120 transmission electron microscope | Zeiss | Acceleration Voltage 120KV | |
| Sapphire X-ray detector | EDAX-Amatek | ||
| Cell culture plastic | TPP | ||
| NHS-Esther Atto 565 | ATTO-TEC GmbH | AD 565-31 | |
| NHS-Esther Atto 488 | ATTO-TEC GmbH | AD 488-31 | |
| Cy5 miRNA Label IT kit | Mirus Bio | MIR 9650 | |
| Biotin Atto 565 | ATTO-TEC GmbH | AD 565-71 | |
| Collagense Type IV Gibco | Thermo Scientific | 17104019 | |
| Endothelial growth medium, EGM-2 | Lonza | CC-3156 & CC-4176 | |
| Penicillin/Streptomycin | Thermo Scientific | 15140122 | 100 U/ml, 100µg/ml |
| Matrigel | BD Biosciences | 356234 | |
| anti-PECAM-1 antibody | Santa Cruz | sc-1506 | |
| MS MACS columns | Miltenyi Biotec | 130-042-201 | |
| Near-IR Live/Dead Cell Stain Kit | Thermo Scientific | L10119 | |
| Cy3 Dye-Labeled Pre-miR Negative Control | Thermo Scientific | AM17120 | "Cy3-miR" or "Cyanine-miR3" in the manuscript |
| Pre-miR miRNA Precursor Molecules – Negative Control | Thermo Scientific | AM17110 | "scr-miR" in the manuscript |
| Anti-hsa-miR92a-3p synthetic Inhibitor | Thermo Scientific | AM10916 | |
| LSM 780 ELYRA PS.1 system | Zeiss | ||
| Paraformaldehyde | Sigma Aldrich | 158127 | 4% solution in PBS |
| DAPI nuclear stain | Thermo Scientific | D1306 | |
| NucleoSpin RNA isolation Kit | Machery-Nagel | 740955 | |
| mirVana miRNA Isolation Kit | Thermo Scientific | AM1560 | |
| TaqMan MicroRNA Reverse Transcription Kit | Thermo Scientific | 4366596 | |
| StepOnePlus Real-Time PCR System | Applied Biosystems | ||
| High-Capacity cDNA Reverse Transcription Kit | Thermo Scientific | 4368814 | |
| hsa-miR-92a TaqMan assay | Thermo Scientific | 000431 | Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU |
| FastGene Taq Ready Mix | Nippon Genetics | LS27 | |
| ITGA5 TaqMan assay | Thermo Scientific | Hs01547673_m1 | |
| RNU6B TaqMan assay | Thermo Scientific | 001093 | |
| 18S rRNA Endogenous Control | Thermo Scientific | 4333760F | |
| Gelatin | Sigma Aldrich | G7041 | |
| CellTrace Calcein Red-Orange | Thermo Scientific | C34851 | |
| PBS | Pan Biotech | P04-53500 | |
| BSA | Sigma Aldrich | ||
| MACS buffer | Miltenyi Biotec | 130-091-221 | |
| Agarose | Sigma Aldrich | A9539 | |
| 7.1 Tesla animal MRI system | Bruker Corporation | A7906 | |
| ImageJ software | National Institutes of Health | upgraded with an AngiogenesisAnalyzer (NIH) | |
| MPS device | Bruker Biospin | ||
| Matlab software | Mathworks | ||
| Ring Neodym Magnet | magnets4you GmbH | RM-10x04x05-G | ø 10 mm; remanescence is ~1.3T, coercivity ≥ 955 kA/m |
| Click-iT EdU Alexa Fluor 647 Imaging Kit | Thermo Scientific | C10340 | |
| FluorSave Reagent | Merck | 345789 | |
| Ultrasonic bath | Bandelin electronic | Type: RK 100 SH |
Referências
- Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11 (4), 232-246 (2014).
- Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115 (14), 1866-1875 (2007).
- Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4 (2), 177-181 (2011).
- Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54 (17), 1619-1626 (2009).
- Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy – Principles and Challenges. , (2015).
- Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
- Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15 (8), 541-555 (2014).
- Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6 (31), 30675-30703 (2015).
- Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10 (8), 897-909 (2008).
- Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
- Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6 (3), 291-301 (2016).
- Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5 (7), 667-685 (2015).
- Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. , (2016).
- Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
- Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14 (6), 10710-10726 (2013).
- Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9 (7), 999-1017 (2014).
- Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12 (8), 2353-2364 (2016).
- Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21 (2), 66-72 (2010).
- Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35 (27), 7909-7918 (2014).
- Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91 (2), 223-227 (2012).
- Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211 (2), 907-913 (1954).
- Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34 (12), 1893-1902 (2002).
- Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8 (1), 28-40 (2001).
- Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
- Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
- Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89 (1), 41-48 (2012).
- Andrade, &. #. 1. 9. 4. ;. L., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324 (10), 1753-1757 (2012).
- Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10 (4), e0123159 (2015).
- Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32 (35), 9218-9230 (2011).
- Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
- Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324 (5935), 1710-1713 (2009).
- Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15 (9), 1989-1998 (2011).
- Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
- Cheng, K., Li, T. -. S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106 (10), 1570-1581 (2010).
- Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. , A.3B.1-A.3B.2 (2001).
- Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29 (5), 1232-1241 (2012).
- Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12 (2), 337-346 (2016).
- Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8 (5), 1-10 (2013).
- Hernando, D., Kühn, J. -. P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37 (3), 717-726 (2013).
- Soenen, S. J., Rivera-Gil, P., Montenegro, J. -. M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6 (5), 446-465 (2011).
- Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27 (3), 85 (2008).
- Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
- Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
- Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
- Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
- Chen, C. -. H., Sereti, K. -. I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19 (8), 1757-1772 (2015).
- Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16 (10), 2413-2421 (2012).
- Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9 (23), 4017-4026 (2013).
- Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10 (1), 225-234 (2014).
- Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2 (8), 794-802 (2009).
- Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4 (6), 149 (2013).
- Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
- Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6 (7), 832-842 (2010).
- Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21 (6), 1121-1135 (2012).
- Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35 (30), 8528-8539 (2014).
