JoVE Journal > Medicine
Summary
Abstract
Introduction
Protocol
Resultados
Discussion
Declarações
Acknowledgements
Materials
Referências
Tadução automática
Please note that all translations are automatically generated. Click here for the English version.
Medicina

הכנה<em> במבחנה</em> אפיון ממוגנטים miR-modified לתאי אנדותל

Published: May 02, 2017
doi:
10.3791/55567
, , , , , ,
1Reference and Translation Center for Cardiac Stem Cell Therapy (RTC), Department of Cardiac Surgery,University of Rostock, 2Physikalisch-Technische Bundesanstalt, 3Department of Radiology and Neuroradiology,Ernst-Moritz-Arndt-University Greifswald, 4Electron Microscopy Center,University of Rostock

Summary

כתב היד הזה מתאר את משלוח יעיל, שאינו ויראלי של miR לתאי אנדותל ידי וקטור PEI / MNP ו המגנטיזציה שלהם. לכן, בנוסף שינוי גנטי, גישה זו מאפשרת להדרכת תא מגנטית ויכולת גילוי MRI. הטכניקה יכולה לשמש כדי לשפר את המאפיינים של מוצרי תא טיפוליים.

Abstract

נכון להיום, הטיפולים כירורגיים תרופתיים הזמינים עבור מחלות לב וכלי דם (CVD) מוגבלים ולעתים קרובות פליאטיבי. במקביל, טיפולי גני תא הם מאוד גישות חלופיות מבטיחות לטיפול CVD. עם זאת, היישום הקליני הרחב של ריפוי גנטי מוגבל מאוד על ידי חוסר מערכות למסירת הגן מתאימות. ההתפתחות של וקטורים למסירת הגן מתאימים יכולה לספק פתרון לאתגרים נוכחיים טיפול בתא. בפרט, חסרונות קיימים, כגון יעילות מוגבלת ושימור תאי נמוך ב האיבר נפצע, ניתן להתגבר על ידי הנדסת תא מתאימה (כלומר, גנטי) לפני ההשתלה. הפרוטוקול המובא מתאר את השינוי החולף היעיל ובטוח של תאי האנדותל באמצעות ננו-חלקיקים מגנטיים פאראמגנטי polyethyleneimine (PEI / MNP) וקטור משלוח מבוסס. כמו כן, האלגוריתם ושיטות לאפיון תאים מוגדרים. Intracellu המוצלחמסירה של microRNA (miR) לתוך האדם ורידים טבורי תאים אנדותל (HUVECs) הושגה מבלי להשפיע על כדאיות התא, פונקציונליות, או תקשורת בין תאיים. יתר על כן, גישה זו הוכחה לגרום השפעה תפקודית חזקה מיר exogenous הציג. חשוב לציין, היישום של וקטור זה מבוסס MNP מבטיח מגנטיזציה התא, עם אפשרויות נלוות של מיקוד מגנטי לא מעקב פולשני MRI. זה עשוי לספק בסיס מגנטי מונחה, מהונדס גנטית תרפויטים תא שניתן לפקח ללא פולשנית עם MRI.

Introduction

ג'ין וטיפול תא הם כלים רבים עצמה יש פוטנציאל לפתור אתגרים נוכחיים בטיפול CVD. למרות העובדה כי הן הגישות הללו נבדקות כעת בניסויים קליניים, הם עדיין אינם מוכנים ליישום קליני רחב 1. יש לציין, גישה משותפת להתמודדות עם האתגרים של גן לבין טיפול בתא היא לפתח וקטורים למסירת גן רבים תכליתיים מתאימים ליישום קליני. היעדר מערכות למסירת הגן בטוחות ויעילות הוא הדאגה העיקרית של ריפוי גנטי. במקביל, ההנדסה הגנטית של מוצרי הסלולר לפני ההשתלה יכולה להתגבר על האתגרים הרציניים של טיפול בתא, כגון יעילות נמוכה (למשל, בתחום הלב, רק ~ 5% של שיפור תפקודי מושגת פוסט-תאי גזע להשתלת 1 ) ושימור / engraftment עני באתר של פציעה (כלומר, החזקת תא יורד מתחת 5 – 10% בתוך דקות עד שעות POst-יישום, ללא קשר לתוואי ממשל 2, 3, 4).

נכון להיום, וקטורים ויראליים מאוד יעלו מערכות שאינן ויראליות במונחים של יעילות, אשר הביאה היישום הרחב יותר שלהם בניסויים קליניים (~ 67%) 5. עם זאת, כלי רכב ויראלי לשאת בסיכונים חמורים, כגון חיסוני (ואת התגובה הדלקתית שלאחר מכן, עם סיבוכים חמורים), oncogenicity, ומגבלות בגודל של החומר הגנטי הנישא 6. בשל חששות בטיחות אלה לבין העלויות הגבוהות של ייצור וקטור ויראלי, השימוש במערכות הלא-ויראלית עדיף במקרים מסוימים 7, 8. היא מתאימה במיוחד עבור הפרעות הדורשות תיקון גנטי חולף, כגון הביטוי של גורמי גדילה השליטה אנגיוגנזה (למשל, לטיפול CVD) או deliveר"י של חיסונים.

בקבוצה שלנו, מערכת מסירה תוכננה על ידי שילוב מסועף 25-kDa polyethyleneimine (תש"ן) ואת חלקיקי תחמוצת ברזל פאראמגנטי (MNP) קשורים יחדיו על ידי האינטראקציה ביוטין- streptavidin 9. וקטור זה הוא כלי פוטנציאלי עבור הנדסה גנטית של תאי, המאפשר המגנטיזציה שלהם סימולטני לפני ההשתלה. זה האחרון מספק בסיס הדרכה / שימור מגנטי, אשר מבטיחה במיוחד בימינו, כמו טכניקות מיקוד מגנטיות מתקדמות מפותח בהצלחה 10. יתר על כן, התא מגנטי תגובה וכתוצאה מכך יש את הפוטנציאל להיות פולשני במעקב דימות בתהודה מגנטית (MRI) או הדמית חלקיקים מגנטית 11, 12.

במקרה של וקטור PEI / MNP, polyamine מבטיח התעבות חומצות גרעין ובכך הגנה מפני גורם משפיל ים, הפנמת וקטור בתאים, ו endosomal להימלט 5. MNPs משלימים את המאפיינים של PEI, לא רק במונחים של הדרכה מגנטי, אלא גם על ידי הפחתת הרעילות 7 הידוע PEI, 13, 14. בעבר, תש"ן / נכסים וקטור MNP הותאמו מבחינת יעילות משלוח (כלומר, pDNA ו מירנה) ובטיחות באמצעות פיברובלסטים ותאי גזע mesenchymal אנושי 15, 16.

בכתב היד הזה, פרוטוקול מפורט על היישום של PEI / MNPs עבור הדור של תאי-modified מירנה מתואר 17. לשם כך, HUVECs משמש ומהווה מודל הוקם עבור אנגיוגנזה במבחנה. הם מאתגר transfect והם רגישים השפעה רעילה 18, 19,התחת = "Xref"> 20. בנוסף, אנו מספקים אלגוריתם להעריך תאים כאלה במבחנה, כולל מיקוד שלהם, תקשורת בין-תאית, וזיהוי MRI.

Protocol

מייתרי טבור אדם בידוד תא התקבלו לאחר לידה מ הודיעו, נשים בריאות שנתנו הסכימו בכתב אל השימוש בחומר זה לצורך המחקר על פי הצהרת הלסינקי. הוועדה האתית של אוניברסיטת רוסטוק אישרה את המחקר הציג (reg. מס '2011 06, ממושכת 23 בספטמבר, 2013). 1. ה…

Representative Results

המטרה העיקרית של הפרוטוקול המוצע היא לייצר מגנטי תגובת תאי miR-modified וכדי לנהל האפיון המדויק שלהם (איור 1). כתוצאה מכך, תאי transfected ביעילות, מגיבים בחירה מגנטית והדרכה לזיהוי באמצעות MRI, יש לקבל. <p class="jove_content" fo:keep-together.within-page="1" style=";text-align:right;directi…

Discussion

את ייצור תאי מהונדסים גנטית עמוסה חלקיקים פאראמגנטי לקבלת הנחיות נוספות מגנטית נשלטת שלהם מוצג בפרוטוקול הנוכחי. היישום המוצלח של אסטרטגיה זו מאפשר לפתרון קשיים מסוימים של טיפול בתא, כגון החזקה נמוכה engraftment העני באזור נפצע 2, 3, <s…

Declarações

The authors have nothing to disclose.

Acknowledgements

ברצוננו להודות ג פולדה (מרכז מיקרוסקופי אלקטרונים, רוסטוק אונ', גרמניה) עבור התמיכה הטכנית ברכישת תמונות TEM של חלקיקים פאראמגנטי מסוננים בביצוע ניתוח רנטגן שלהם. העבודה מתבצעת על רוסטוק RTC נתמכה על ידי המשרד הפדרלי לחינוך ולמחקר גרמניה (FKZ 0312138A, FKZ 316,159 ו VIP + 03VP00241) ואת פומרניה מדינת מקלנבורג-מערב עם הקרנות המבניות של האיחוד האירופי (ESF / IV-WM-B34- 0030/10 ו ESF / IV-BM-B35-0010 / 12) ועל ידי DFG (DA 1296-1), ורטיבות-קרן, וקרן הלב גרמנית (F / 01/12). פרנק Wiekhorst נתמכה על ידי תוכנית המחקר FP7 האיחוד האירופי "Nanomag" FP7-NMP-2013-גדול 7.

Materials

PEI 25 kDa Sigma Aldrich 408727
EZ-Link Sulfo-NHS-LC-Biotin Thermo Scientific 21335
PD-10 Desalting Columns GE Healthcare 17085101 Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2% Sigma Aldrich 7285
Glycine Sigma Aldrich 410225
Pierce Biotin Quantitation Kit Thermo Scientific 28005
 Microplate reader Model 680 Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles Promega Z5481
Millex-HV PVDF Filter Merck SLHV013SL 0.45µm
Libra 120 transmission electron microscope  Zeiss Acceleration Voltage 120KV
Sapphire X-ray detector EDAX-Amatek
Cell culture plastic TPP
NHS-Esther Atto 565 ATTO-TEC GmbH AD 565-31
NHS-Esther Atto 488  ATTO-TEC GmbH AD 488-31
Cy5 miRNA Label IT kit Mirus Bio MIR 9650
Biotin Atto 565 ATTO-TEC GmbH AD 565-71
Collagense Type IV Gibco Thermo Scientific 17104019
Endothelial growth medium, EGM-2 Lonza CC-3156 & CC-4176
Penicillin/Streptomycin Thermo Scientific 15140122 100 U/ml, 100µg/ml
Matrigel BD Biosciences 356234
anti-PECAM-1 antibody Santa Cruz sc-1506
MS MACS columns Miltenyi Biotec  130-042-201
Near-IR Live/Dead Cell Stain Kit Thermo Scientific L10119
Cy3 Dye-Labeled Pre-miR Negative Control Thermo Scientific AM17120 "Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules – Negative Control  Thermo Scientific AM17110 "scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor  Thermo Scientific AM10916
LSM 780 ELYRA PS.1 system Zeiss
Paraformaldehyde Sigma Aldrich 158127 4% solution in PBS
DAPI nuclear stain Thermo Scientific D1306
NucleoSpin RNA isolation Kit Machery-Nagel 740955
mirVana miRNA Isolation Kit Thermo Scientific AM1560
TaqMan MicroRNA Reverse Transcription Kit Thermo Scientific 4366596
StepOnePlus Real-Time PCR System Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814
hsa-miR-92a TaqMan assay Thermo Scientific 000431 Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix Nippon Genetics LS27
ITGA5 TaqMan assay Thermo Scientific Hs01547673_m1
RNU6B TaqMan assay Thermo Scientific 001093
18S rRNA Endogenous Control Thermo Scientific 4333760F
Gelatin Sigma Aldrich G7041
CellTrace Calcein Red-Orange Thermo Scientific C34851
PBS Pan Biotech P04-53500
BSA Sigma Aldrich
MACS buffer Miltenyi Biotec  130-091-221
Agarose Sigma Aldrich A9539
7.1 Tesla animal MRI system Bruker Corporation A7906
ImageJ software National Institutes of Health upgraded with an AngiogenesisAnalyzer (NIH)
MPS device Bruker Biospin
Matlab software Mathworks
Ring Neodym Magnet  magnets4you GmbH RM-10x04x05-G ø 10 mm; remanescence is ~1.3T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit Thermo Scientific C10340
FluorSave Reagent Merck 345789
Ultrasonic bath Bandelin electronic Type: RK 100 SH
DOWNLOAD MATERIALS LIST

Referências

  1. Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11 (4), 232-246 (2014).
  2. Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115 (14), 1866-1875 (2007).
  3. Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4 (2), 177-181 (2011).
  4. Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54 (17), 1619-1626 (2009).
  5. Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy – Principles and Challenges. , (2015).
  6. Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
  7. Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15 (8), 541-555 (2014).
  8. Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6 (31), 30675-30703 (2015).
  9. Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10 (8), 897-909 (2008).
  10. Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
  11. Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6 (3), 291-301 (2016).
  12. Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5 (7), 667-685 (2015).
  13. Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. , (2016).
  14. Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
  15. Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14 (6), 10710-10726 (2013).
  16. Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9 (7), 999-1017 (2014).
  17. Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12 (8), 2353-2364 (2016).
  18. Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21 (2), 66-72 (2010).
  19. Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35 (27), 7909-7918 (2014).
  20. Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91 (2), 223-227 (2012).
  21. Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211 (2), 907-913 (1954).
  22. Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34 (12), 1893-1902 (2002).
  23. Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8 (1), 28-40 (2001).
  24. Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
  25. Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
  26. Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89 (1), 41-48 (2012).
  27. Andrade, &. #. 1. 9. 4. ;. L., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324 (10), 1753-1757 (2012).
  28. Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10 (4), e0123159 (2015).
  29. Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32 (35), 9218-9230 (2011).
  30. Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
  31. Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324 (5935), 1710-1713 (2009).
  32. Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15 (9), 1989-1998 (2011).
  33. Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
  34. Cheng, K., Li, T. -. S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106 (10), 1570-1581 (2010).
  35. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. , A.3B.1-A.3B.2 (2001).
  36. Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29 (5), 1232-1241 (2012).
  37. Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12 (2), 337-346 (2016).
  38. Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8 (5), 1-10 (2013).
  39. Hernando, D., Kühn, J. -. P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37 (3), 717-726 (2013).
  40. Soenen, S. J., Rivera-Gil, P., Montenegro, J. -. M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6 (5), 446-465 (2011).
  41. Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27 (3), 85 (2008).
  42. Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
  43. Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
  44. Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
  45. Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
  46. Chen, C. -. H., Sereti, K. -. I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19 (8), 1757-1772 (2015).
  47. Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16 (10), 2413-2421 (2012).
  48. Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9 (23), 4017-4026 (2013).
  49. Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10 (1), 225-234 (2014).
  50. Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2 (8), 794-802 (2009).
  51. Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4 (6), 149 (2013).
  52. Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
  53. Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6 (7), 832-842 (2010).
  54. Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21 (6), 1121-1135 (2012).
  55. Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35 (30), 8528-8539 (2014).

Tags

Keywords: Magnetized CellsMiR-modified CellsEndothelial CellsCell MagnetizationMicroRNA TransfectionPolyethyleneimeneSuper Paramagnetic Iron Oxide NanoparticlesCell TherapyRegenerative MedicineCell RetentionCell SurvivalConfocal MicroscopyStructured Illumination Microscopy
check_url/pt/55567?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citar este artigo
Voronina, N., Lemcke, H., Wiekhorst, F., Kühn, J., Frank, M., Steinhoff, G., David, R. Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells. J. Vis. Exp. (123), e55567, doi:10.3791/55567 (2017).
Baixar citação
Reimpressões e Permissões

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image