MRNA Interactome Capture van Plant Protoplasts
Summary
Hier presenteren wij een interactief capture protocol toegepast op Arabidopsis thaliana leaf mesophyll protoplasten. Deze methode berust op in vivo UV-verknoping en staat voor isolatie en identificatie van plantaardige mRNA-bindende eiwitten uit een fysiologische omgeving.
Abstract
RNA-bindende eiwitten (RBP's) bepalen de fates van RNA's. Zij nemen deel aan alle RNA biogenese pathways en dragen bij tot post-transcriptie gene regulatie (PTGR) van messenger RNAs (mRNAs). In de afgelopen jaren zijn een aantal mRNA gebonden proteomen uit gist- en zoogdiercellijnen succesvol geïsoleerd door gebruik te maken van een nieuwe methode genaamd "mRNA interactome capture", die het mogelijk maakt om mRNA-bindende eiwitten (mRBP's) te identificeren. Direct vanuit een fysiologische omgeving. De werkwijze bestaat uit in vivo ultraviolette (UV) verknoping, aftrek en zuivering van messenger ribonucleoproteïne complexen (mRNPs) door oligo (dT) kralen, en de daaropvolgende identificatie van de verknoopte eiwitten door middel van massaspectrometrie (MS). Heel recent, door dezelfde methode toe te passen, zijn verschillende planten mRNA gebonden proteomen gelijktijdig gerapporteerd uit verschillende Arabidopsis weefsel bronnen: geëtolideerde zaailingen, bladweefsel,Blad mesofyl protoplasten, en gekweekte wortelcellen. Hier presenteren wij de geoptimaliseerde mRNA interactome capture methode voor Arabidopsis thaliana leaf mesophyll protoplasten, een celtype dat dient als een veelzijdig hulpmiddel voor experimenten die diverse cellulaire assays omvatten. De voorwaarden voor optimale eiwitopbrengst omvatten de hoeveelheid startweefsel en de duur van UV-bestraling. In het mRNA gebonden proteoom verkregen uit een middelgrote experiment (10 7 cellen) bleek dat RBP's die op RNA-bindende capaciteit beschikten, te oververtegenwoordigd waren en veel nieuwe RBP's werden geïdentificeerd. Het experiment kan opgeschaald worden (10 9 cellen), en de geoptimaliseerde methode kan toegepast worden op andere plantencel typen en soorten om in grote mate te isoleren, te catalogeren en mRNA-gebonden proteomen te vergelijken.
Introduction
Eukaryoten gebruiken meerdere RNA biogenese regulerende pathways om cellulaire biologische processen te behouden. Onder de bekende typen RNA is mRNA zeer divers en draagt de coderingscapaciteit van eiwitten en hun isoformes 1. De PTGR-weg leidt de fatsussen van pre-mRNAs 2 , 3 . RBP's uit verschillende genfamilies regelen de regulering van RNA, en in PTGR leiden specifieke mRBPs mRNAs door directe fysieke interacties, die functionele mRNP's vormen. Daarom is het identificeren en karakteriseren van mRBP's en hun mRNP's van cruciaal belang om de regulering van cellulaire mRNA-metabolisme 2 te begrijpen. In de afgelopen drie decennia zijn diverse in vitro methoden – waaronder RNA-elektroforetische mobiliteitsverschuiving (REMSA) -assays, systematische evolutie van liganden door exponentiële verrijkingstests (SELEX) gebaseerd op bibliotheek-afgeleide constructen, RNA Bind-n-Seq (RBNS), radioactief gemerk of kwantitatiefFluorescentie-RNA-bindingsbepalingen, röntgenkristallografie en NMR-spectroscopie 4 , 5 , 6 , 7 , 8 , 9 – zijn op grote schaal toegepast op studies van RBP's, voornamelijk uit zoogdiercellen. De resultaten van deze studies van zoogdieren RBP's kunnen worden gezocht via de RNA-bindende Protein DataBase (RBPDB), die de gepubliceerde waarnemingen 10 verzamelt .
Hoewel deze in vitro benaderingen krachtige tools zijn, bepalen ze de gebonden RNA-motieven uit een bepaald RNA-pool van sequenties en zijn daarom beperkt in hun vermogen om nieuwe doel RNA's te ontdekken. Hetzelfde geldt voor berekeningsstrategieën om genoom-brede RBP's te voorspellen, die zijn gebaseerd op het behoud van eiwitsequentie en structuur 15 . Om dit te overwinnen is een nieuwe experimentele methode haS is vastgesteld die het mogelijk maakt om de RNA-motieven te identificeren die een RBP van belang heeft, alsmede voor de bepaling van de precieze plaats van binding. Deze methode, genaamd "verknoping en immunoprecipitatie" (CLIP), bestaat uit in vivo UV-verknoping gevolgd door immunoprecipitatie 11 . Vroege studies hebben aangetoond dat fotoactivering van DNA- en RNA-nucleotiden kan optreden bij excitatie UV-golflengten groter dan 245 nm. De reactie door thymidine lijkt gunstig te zijn (rang in volgorde van verminderde fotoreactiviteit: dT> dC> rU> rC, dA, dG) 12 . Door gebruik te maken van UV-licht met een golflengte van 254 nm (UV-C) werd geconstateerd dat covalente bindingen tussen RNA-nucleotiden en eiwitresiduen worden gecreëerd bij slechts enkele Astromen (Å). Het fenomeen wordt dus de "nul-lengte" verknoping van RNA en RBP genoemd. Dit kan gevolgd worden door een strikte zuivering procedure Duur met weinig achtergrond 13 , 14 .
Een complementaire strategie voor CLIP is het combineren van in vivo UV-verknoping met eiwitidentificatie om het landschap van RBP's te beschrijven. Een aantal van dergelijke genoomwijdte mRNA gebonden proteomen zijn geïsoleerd uit gistcellen, embryonale stamcellen (ESC's) en menselijke cellijnen ( dwz HEK293 en HeLa) met behulp van deze nieuwe experimentele aanpak, genaamd "mRNA interactome capture" 18 , 19 , 20 , 21 . De methode bestaat uit in vivo UV-verknoping gevolgd door mRNP zuivering en MS-gebaseerde proteomics. Door deze strategie toe te passen, zijn veel nieuwe "maanlichtende" RBP's die niet-kanonieke RBD's bevatten, ontdekt en is het duidelijk geworden dat meer eiwitten RNA-bindende capaciteiten hebben dan eerder werd verondersteld"> 15 , 16 , 17. Het gebruik van deze methode zorgt voor nieuwe toepassingen en voor de mogelijkheid om nieuwe biologische vragen te beantwoorden bij het onderzoeken van RBP's. Bijvoorbeeld, heeft een recente studie het behoud van het mRNA gebonden proteome onderzocht (de kern RBP Proteome) tussen gist en menselijke cellen 22 .
Plant RBP's zijn al gebleken betrokken te zijn bij groei en ontwikkeling ( bijv . In de posttranscriptie regulatie van bloeitijd, de circadiaanse klok en genuitdrukking in mitochondriën en chloroplasten) 24 , 25 , 26 , 27 , 28 , 29 . Bovendien worden ze gedacht aan functies in de cellulaire processen die reageren op abiotische stressen ( bijvoorbeeld koud, droogte, saLinheid en absciszuur (ABA)) 31 , 32 , 33 , 34 . Er zijn meer dan 200 voorspelde RBP genen in het Arabidopsis thaliana genoom, gebaseerd op RNA herkenningsmotief (RRM) en K homologie (KH) domein sequentie motieven; In rijst zijn ongeveer 250 genoteerd 35 , 36 . Het is opmerkelijk dat veel voorspelde RBP's uniek zijn voor planten ( bijv. Geen metazoan-orthologen tot ongeveer 50% van de voorspelde Arabidopsis- RBP's die een RRM-domein bevatten) 35 , wat suggereert dat veel nieuwe functies kunnen dienen. De functies van de meeste voorspelde RBP's blijven uncharacterized 23 .
De isolatie van mRNA gebonden proteomen uit Arabidopsis geëtolideerde zaailingen, bladweefsel, gekweekte wortelcellen en bladmemofyl protoplasten door het gebruik vanMRNA interactome capture is recentelijk gerapporteerd 38 , 39 . Deze studies tonen het sterke potentieel om in de nabije toekomst systematisch de functionele RBP's in planten te catalogeren. Hier presenteren we een protocol voor mRNA interactome capture van plant protoplasten (dat wil zeggen cellen zonder celwanden). Arabidopsis thaliana blad mesofyl protoplasten zijn het belangrijkste type bladcel. De geïsoleerde protoplasten zorgen voor optimale toegang van UV licht aan de cellen. Dit celtype kan gebruikt worden in analyses die transient eiwitten voor functionele karakterisering 40 , 41 uitdrukken. Bovendien is protoplasting toegepast op verscheidene andere plantencelsoorten en soorten 42 , 43 , 44 ( bijv. Petersson et al ., 2009; Bargmann en Birnbaum, 2010; en Hong et al ., 2012).
<P class = "jove_content"> De methode omvat in totaal 11 stappen ( figuur 1A ). Arabidopsis blad mesofyl protoplasten worden eerst geïsoleerd (stap 1) en worden vervolgens UV bestraald om verknoopte mRNPs (stap 2) te vormen. Wanneer protoplasten worden gelicht onder denatureringsomstandigheden (stap 3), worden de verknoopte mRNP's in lysis / bindingsbuffer vrijgegeven en door oligo-d (T) 25 kralen (stap 4) getrokken. Na verscheidene ronden strengende wassen worden de mRNP's gezuiverd en verder geanalyseerd. De gedenatureerde peptiden van mRBPs worden verteerd door eiwitase K voordat de verknoopte mRNA's worden gezuiverd en de RNA-kwaliteit wordt geverifieerd door qRT-PCR (stappen 5 en 6). Na behandeling met RNase en eiwitconcentratie (stap 7) wordt de proteïnekwaliteit geregeld door SDS polyacrylamide gelelektroforese (SDS-PAGE) en zilverkleuring (stap 8). Het verschil in eiwitbandpatronen kan gemakkelijk worden geïllustreerd tussen een verknoopt monster (CL) en een niet-verknoopt monster (niet-CL;Het negatieve controle monster van protoplasten die niet aan UV-bestraling worden blootgesteld). De identificatie van eiwitten wordt bereikt door middel van MS-gebaseerde proteomics. De eiwitten uit het CL-monster worden gescheiden door eendimensionale polyacrylamidegelelektroforese (1D-PAGE) om mogelijke achtergrondverontreiniging te verwijderen, "in-gel gedigereerd" in korte peptiden met behulp van trypsine, en worden gezuiverd (stap 9). Nano reverse-phase vloeistofchromatografie gekoppeld aan massaspectrometrie (nano-LC-MS) maakt het mogelijk de hoeveelheid definitieve eiwitten in het mRNA gebonden proteome te bepalen (stap 10). Tenslotte worden de geïdentificeerde mRBP's gekenmerkt en gecatalogiseerd met behulp van bioinformatische analyse (stap 11).Protocol
Representative Results
Discussion
We hebben succesvol mRNA interactome capture toegepast, ontwikkeld voor gist en menselijke cellen, om blad mesofyl protoplasten te planten. Bladmacofylcellen zijn de belangrijkste aardweefsel in plantenblaadjes. Het grote voordeel van deze methode is dat het in vivo verknoping gebruikt om de eiwitten uit een fysiologische omgeving te ontdekken.
In dit protocol presenteren we voornamelijk een aantal geoptimaliseerde experimentele condities ( bijvoorbeeld het aantal protoplas…
Declarações
The authors have nothing to disclose.
Acknowledgements
Wij erkennen het laboratorium van prof. Joris Winderickx, die de UV-verknopingsapparaat heeft voorzien van de conventionele UV-lamp. KG wordt ondersteund door het onderzoeksfonds KU Leuven en erkent steun van FWO-subsidie G065713N.
Materials
| REAGENTS | |||
| 0.8 M Mannitol | Sigma | M1902-500G | Primary isotonic Enzyme solution & MMg solution |
| 2M KCl | MERCK | Art. 4935 | Primary isotonic Enzyme solution & W5 buffer |
| 0.2 M MES (pH 5.7) (4-morpholineethanesulfonic acid) |
Sigma-aldrich | M2933 | Primary isotonic Enzyme solution, W5 buffer & MMg solution, Filtration sterilization |
| Cellulase R10 | Yakult Pharmaceutical Industry Co., Ltd. | CELLULASE “ONOZUKA” R-10, 10 g |
Final isotonic enzyme solution |
| Macerozyme R10 | Yakult Pharmaceutical Industry Co., Ltd. | MACEROZYME R-10, 10g | Final isotonic enzyme solution |
| 10% (w/v) BSA (Bovine Serum Albumin) |
Sigma-aldrich | A7906-100G | Final isotonic enzyme solution & Filtration sterilization |
| 1M CaCl2 | Chem-Lab NV | CL00.0317.1000 | Final isotonic enzyme solution, W5 buffer & Digestion buffer |
| 1M NaCl | Fisher Chemical | S/3160/60 | W5 buffer |
| 2M MgCl2 | Sigma | M8266-100G | MMg solution |
| 1M LiCl (Lithium Chloride) |
Acros | 199885000 | Lysis/binding buffer, Wash buffer 1, Wash buffer 2 & Low salt buffer |
| 5% (w/v) LiDS (Lithium Dodecyl Sulphate) |
Sigma-aldrich | L4632-25G | Lysis/binding buffer, Wash buffer 1 & Filtration sterilization |
| 1M DTT (Dithiothreitol) |
Thermo Fisher Scientific Wash buffer 1 & Wash buffer 2 |
307866 | Lysis/binding buffer, |
| 1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) | Acros & Fisher Chemical |
167620010 & H/1200/PB15 |
Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer |
| 0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) | Sigma-aldrich | ED-500G | Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer |
| Tween 20 | MERCK | 8.22184.0500 | Regeneration of oligo-d(T)25 beads |
| 0.1 M NaOH | VWR PROLABO CHEMICALS | 28244.295 | Regeneration of oligo-d(T)25 beads |
| 1X PBS (pH 7.4) (Phosphate Buffered Saline) containing (NaCl; KCl; Na2HPO4; KH2PO4) |
Fisher Chemical, MERCK, Sigma-aldrich & SAFC |
S/3160/60, Art. 4935, 71640-250G & 60230 |
Regeneration of oligo-d(T)25 beads |
| Proteinase K solution (2 μg/μL) | Thermo Fisher Scientific | 11789020 | Protein digestion |
| Loading dye | Invitrogen | LC5925 | SDS-PAGE |
| qPCR master mix | Promega | A6001 | qRT-PCR assay |
| RNase Cocktail | Thermo Fisher Scientific | AM2286 | RNA digestion |
| Methanol | Sigma-aldrich | 322415 | Gel fixation and gel destaining |
| Acetic acid | Sigma-aldrich | 537020 | Gel fixation and gel destaining |
| Coomassie Brilliant Blue R-250 | Thermo Fisher Scientific | 20278 | Gel staining |
| 1M NH4HCO3 (Ammonium bicarbonate) |
Sigma-aldrich | 09830-500G | Gel hydration & Digestion buffer |
| CH3CN (Acetonitrile) |
Sigma-aldrich | 34851-100ML | Gel dehydration & Peptide dissolving solution |
| IAA (Iodoacetic acid) |
Sigma-aldrich | I4386-10G | Alkylating agent |
| TFA (Trifluoroacetic acid) |
Sigma-aldrich | 302031-10X1ML | Peptide dissolving solution |
| FA (Formic acid) |
Sigma-aldrich | 06554-5G | Peptide extraction |
| Trypsin solution (6 ng/μL) | Promega | V5280 | Digestion buffer |
| Name | Company | Catalog Number | Comments |
| EQUIPMENT | |||
| Soil | Peltracom | LP2D | Plant growth |
| Vermiculite 3 | Sibli AS | 05VERMICULIET | Plant growth |
| Petri dish (150 x 20 mm) | Sarstedt | 82.1184.500 | Carrier for protoplast suspension |
| 0.22 μm filter | Millipore | SE2M229104 | Homogenization of final isotonic enzyme solution |
| Razorblade | Agar Scientific | T585 | Rosette leaf strips |
| 35-75 μm nylon mesh | SEFAR NITEX | 74010 | Protoplast suspension filtration |
| 50 mL round bottom tubes | Sigma-aldrich | T1918-10EA | Carrier for protoplast suspension |
| Hemocytometer (Bürker hemocytometer) |
MARIENFELD | 650030 | Protoplast cell counting |
| UV crosslinking apparatus (HL-2000 HybriLinker) |
UVP, LLC | UVP95003101 | in vivo UV crosslinking |
| UV lamp (Sankyo-Denki G8T5) |
SANKYO DENKI |
SD G8T5 | in vivo UV crosslinking |
| 50 mL glass syringe | FORTUNA Optima | Z314560 | Homogenization of protoplast lysate |
| Narrow needle (0.9 x 25 mm) | Becton Dickinson microlance 3 | 2021-04 | Homogenization of protoplast lysate |
| Rotator Model L26 | Labinco BV | 26110912 | Sample incubation by rotating |
| Oligo-d(T)25 magnetic beads (5 mg/mL) |
New England BioLabs | S1419S | mRNPs and mRNAs binding and pull-down |
| Magnetic rack | Invitrogen | CS15000 | mRNPs and mRNAs binding and pull-down |
| Centrifugal filter units (Amicon Ultra-4 centrifugal filter units) |
EMD Millipore | UFC800308 | mRBP concentration |
| Pierce Silver Stain Kit | Thermo Fisher Scientific | 24612 | Silver-staining assay |
| RNA purification kit (InviTrap Spin Plant RNA Mini Kit) |
STRATEC Molecular | 1064100300 | RNA purification |
| Spectrophotometer device (NanoDrop 1000 Spectrophotometer) | Thermo Fisher Scientific | ND-1000 | RNA quality and quantity |
| Real-Time PCR cycler (StepOne Real-Time PCR cycler) |
Thermo Fisher Scientific | 4376600 | cDNA quantification |
| µ-C18 columns (Millipore Zip Tip µ-C18 columns) |
Sigma-aldrich | 720046-960EA | Peptide purification |
| Mass spectrometer (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer) |
Thermo Fisher Scientific | IQLAAEGAAPFALGMAZR | Mass spectrometry-based proteomics |
| Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) | Thermo Fisher Scientific | ULTIM3000RSLCNANO | Mass spectrometry-based proteomics |
| C18 column (Easy Spray Pepmap RSLC C18 column) |
Thermo Fisher Scientific | ES800 | Mass spectrometry-based proteomics |
| C18 precolumn (Acclaim Pepmap 100 C18 precolumn) |
Thermo Fisher Scientific | 160321 | Mass spectrometry-based proteomics |
| Name | Company | Catalog Number | Comments |
| Primers for qRT-PCR assay | Sequences | ||
| UBQ10 mRNA (Li et al., 2014) |
Fw: AACTTTGGTGGTTTGTGTTTTGG Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA |
||
| 18S rRNA (Durut et al., 2014) |
Fw: CGTAGTTGAACCTTGGGATG Rv: CACGACCCGGCCAATTA |
||
Referências
- Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16 (9), 533-544 (2015).
- Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582 (14), 1977-1986 (2008).
- Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15 (12), 829-845 (2014).
- Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272 (43), 27274-27280 (1997).
- Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98 (6), 835-845 (1999).
- Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280 (15), 15340-15347 (2005).
- Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33 (22), 7074-7089 (2005).
- Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105 (40), 15317-15322 (2008).
- Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54 (5), 887-900 (2014).
- Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, D301-D308 (2011).
- Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13 (2), 77-83 (2012).
- Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261 (8), 3512-3518 (1986).
- Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16 (9), 323-326 (1991).
- Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8 (3), 491-500 (2013).
- Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270 (6), 2755-2763 (1995).
- Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35 (8), 423-426 (2010).
- Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39 (8), 674-679 (2012).
- Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46 (5), 674-690 (2012).
- Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149 (6), 1393-1406 (2012).
- Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20 (9), 1122-1130 (2013).
- Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20 (1), 127-133 (2013).
- Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6 (10127), 1-9 (2015).
- Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14 (8), 443-453 (2009).
- Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22 (12), 3142-3152 (2003).
- Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16 (3), 731-740 (2004).
- Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18 (2), 203-213 (2010).
- Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
- Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9 (3), e1002986 (2013).
- Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356 (1415), 1755-1759 (2001).
- Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77 (22), 7265-7273 (2005).
- Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56 (421), 3007-3016 (2005).
- Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224 (4), 900-914 (2006).
- Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59 (3), 633-644 (2008).
- Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29 (1), 125-134 (2011).
- Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30 (3), 623-635 (2002).
- Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
- Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77 (4), 964-973 (2005).
- Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6 (29766), 1-13 (2016).
- Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28 (10), 2435-2452 (2016).
- Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2 (7), 1565-1572 (2007).
- Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
- Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21 (6), 1659-1668 (2009).
- Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
- Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55 (5), 390-397 (2012).
- Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7 (3), 570-572 (2014).
- Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26 (3), 1330-1344 (2014).
- Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3 (3), 697-716 (2005).
- Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10 (7), 2930-2936 (2011).
- Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11 (4), 010587 (2012).
- Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12 (42), 1-12 (2016).
- Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25 (7), 864-876 (2015).
- Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21 (3), 163-182 (2002).
- Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7 (458), 1-13 (2011).
- Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5 (11), 976-989 (1994).
- Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20 (18), 3551-3567 (1999).
