MRNA Interactome ללכוד מן Protoplasts הצמח
Summary
כאן, אנו מציגים פרוטוקול האינטראקציה ללכוד להחיל על Arabopopsis thaliana עלה mesophyll protoplasts. שיטה זו מסתמכת באופן קריטי על vivo UV crosslinking ומאפשר בידוד וזיהוי של חלבונים mRNA מחייב הצמח מסביבה פיזיולוגית.
Abstract
RNA מחייב חלבונים (RBPs) לקבוע את גורלם של RNAs. הם משתתפים בכל המסלולים ביוגנזה רנ"א ובמיוחד לתרום שלאחר תקנת גנים תקנה (PTGR) של RNAs השליח (mRNAs). בשנים האחרונות, מספר mRNA-proteomes כבול מן השמרים שורות תאים יונקים היו מבודדים בהצלחה באמצעות שיטה חדשנית בשם "mRNA אינטראקציה ללכוד", המאפשר זיהוי של mRNA מחייב חלבונים (mRBPs) ישירות מתוך סביבה פיזיולוגית. השיטה מורכבת מ – vivo אולטרה סגול (UV) crosslinking, משוך מטה וטיהור של מסנג 'ר ribonucleoprotein קומפלקסים (mRNPs) על ידי חרוזים אוליגו (DT), ואת זיהוי שלאחר מכן של חלבונים crosslinked על ידי ספקטרומטריית מסה (MS). לאחרונה, על ידי יישום שיטה זהה, כמה צמחים mRNA כבול חלבונים דווחו בו זמנית ממקורות רקמה שונים ארבידופסיס : שתילים etiolated, רקמת עלה,עלה prooplasts mesophyll, ותאי שורש תרבותי. כאן, אנו מציגים את אופטימיזציה mRNA אינטראקציה ללכוד שיטת ארבידופסיס thaliana protoplasts mesophyll עלה, סוג התא המשמש כלי רב תכליתי עבור ניסויים הכוללים מבחני הסלולר השונים. התנאים התשואה חלבון אופטימלי כוללים את כמות הרקמות החל ואת משך קרינה UV. ב- mRNA-proteome שהתקבל בניסוי בקנה מידה בינוני (10 7 תאים), RBPs ציינו כי קיבולת ה- RNA מחייב נמצאו לייצג יתר על המידה, ורבים RBPs מזוהים זוהו. הניסוי יכול להיות scaled up (10 9 תאים), ואת השיטה אופטימיזציה ניתן להחיל על סוגי תאים צמחיים אחרים מינים כדי לבודד באופן רחב, קטלוג, ולהשוות proteomes mRNA- קשורה בצמחים.
Introduction
Eukaryotes להשתמש RNA מספר ביוגנזה מסלולים רגולטוריים כדי לשמור על תהליכים ביולוגיים תאיים. בין סוגים ידועים של רנ"א, mRNA הוא מגוון מאוד ונושא קיבולת קידוד של חלבונים ואת האיזופורמים שלהם 1. מסלול PTGR מכוון את גורלם של pre-mRNAs 2 , 3 . RBPs ממשפחות גנים שונים לשלוט על הרגולציה של RNA, ב PTGR, mRNAs ספציפיים mRNAs מדריך דרך אינטראקציות פיזיות ישירות, יצירת mRNPs תפקודית. לכן, זיהוי ואפיון mRBPs ו mRNPs שלהם הוא קריטי להבנת הרגולציה של חילוף החומרים mRNA נייד 2. מעל שלושת העשורים האחרונים, שונים בשיטות חוץ גופית – כולל מבחני ניידות RNASA ניידות (REMSA) מבחנים, אבולוציה שיטתית של ligands ידי מבחני העשרה מעריכי (SELEX) מבוסס על ספריות הנגזרות בונה, RNA Bind-N-Seq (RBNS), radiolabeled או כמותיפלואורסצנטי RNA מחייב מבחני, קריסטלוגרפיה רנטגן, ו ספקטרוסקופיה תמ"ג 4 , 5 , 6 , 7 , 8 , 9 – יושמו באופן נרחב על מחקרים של RBPs, בעיקר תאים יונקים. התוצאות של מחקרים אלה של RBPs יונקים ניתן לחפש באמצעות RNA מחייב DataBase חלבון (RBPDB), אשר אוספת את התצפיות שפורסמו 10 .
למרות אלה בגישות חוץ גופית הם כלים רבי עוצמה, הם קובעים את מוטיבים RNA קשורות מתוך מאגר RNA נתון רצפים ולכן מוגבלים ביכולתם לגלות RNAs היעד החדש. הדבר נכון גם לגבי אסטרטגיות חישוביות לחזות RBPs גנום רחב, אשר מבוססים על שימור רצף מבנה חלבון 15 . כדי להתגבר על זה, שיטה ניסיונית חדשה חהS שהוקם המאפשר זיהוי של מוטיבים RNA כי RBP של עניין אינטראקציה עם, כמו גם על קביעת המיקום המדויק של מחייב. שיטה זו, המכונה "crosslinking ו immunoprecipitation" (CLIP), מורכב ב crosslinking UV vivo ואחריו immunoprecipitation 11 . מחקרים מוקדמים הראו כי photactivation של DNA ו RNA נוקליאוטידים יכול להתרחש אורכי גל UV גדול מ 245 ננומטר. התגובה באמצעות thymidine נראה מועדף (דרגה של photoreactivity ירד: dT ≥ dC> rU> rC, dA, dG) 12 . באמצעות אור UV עם אורך גל של 254 ננומטר (UV-C), נצפתה כי קשרים קוולנטיים בין נוקליאוטידים RNA ו שאריות חלבון נוצרות כאשר בטווח של רק כמה אנגסטרומים (Å). התופעה נקראת אפוא "crosslinking" באורך אפס של RNA ו- RBP. זה יכול להיות ואחריו פרוטה טיהור מחמירים Dure עם רקע קטן 13 , 14 .
אסטרטגיה משלימה CLIP היא לשלב ב vivo UV crosslinking עם זיהוי חלבון כדי לתאר את הנוף של RBPs. מספר פרוטוקולים כאלה של גנום- mRNA, היו מבודדים מתאי שמרים, תאי גזע עובריים (ESCs) וקווים של תאים אנושיים ( כלומר, HEK293 ו- HeLa) תוך שימוש בגישה הניסויית החדשה, הנקראת "mRNA אינטראקציה ללכוד" 18 , 19 , 20 , 21 . השיטה מורכבת של vivo UV crosslinking ואחריו טיהור mRNP ו- MS מבוסס proteomics. על ידי יישום אסטרטגיה זו, רבים חדשים "moonlighting" RBPs המכילים RBDs שאינם קנוניים התגלו, וזה הפך ברור כי יותר חלבונים יש RNA מחייב קיבולת מאשר בעבר היה אמור להיות"15 , 16 , 17. השימוש בשיטה זו מאפשר ליישומים חדשים וליכולת לענות על שאלות ביולוגיות חדשות בעת חקר RBPs לדוגמה, מחקר שנערך לאחרונה בחן את שימור של פרוטאומה ה- mRNA קשור (הליבה RBP פרוטאומה) בין שמרים לתאים אנושיים 22 .
RBPs צמחים כבר נמצא להיות מעורב בצמיחה ופיתוח ( למשל , בתקנה שלאחר תעתיק של זמן הפריחה, השעון היממה, ביטוי גנים במיטוכונדריה ו chloroplasts) 24 , 25 , 26 , 27 , 28 , 29 . יתר על כן, הם חשבו לבצע פונקציות בתהליכים הסלולר להגיב על מדגיש abiotic ( למשל, קר, בצורת, saLines, וחומצה אבסיסית (ABA)) 31 , 32 , 33 , 34 . ישנם יותר מ 200 גנים RBP החזוי בגנום ארבידופסיס thaliana , המבוססת על מוטיב הכרה RNA (RRM) ו K הומולוגיה (KH) מוטיבים רצף מושלם; באורז, כ -250 כבר ציינו 35 , 36 . יש לציין כי רבים חזו כי RBPs נראים ייחודיים לצמחים ( למשל, לא מטאזואנים אורתולוגים לכ 50% של ארבידופסיס RBPs החזוי המכיל תחום RRM) 35 , מה שמרמז כי רבים עשויים לשרת פונקציות חדשות. הפונקציות של רוב RBPs החזוי להישאר uncharacterized 23 .
בידוד של proteomes mRNA קשורה מן שתילים ארבידופסיס etiolated, רקמת עלה, תאים שורש תרבותי, ו protoplasts mesophyll עלה באמצעות שימושלכידת mRNA אינטראקציה לאחרונה דווח 38 , 39 . מחקרים אלה מדגימים את הפוטנציאל החזק של קיטלוג שיטתי של RBPs פונקציונליים בצמחים בעתיד הקרוב. כאן, אנו מציגים פרוטוקול לכידת mRNA אינטראקציה מן protoplasts צמח ( כלומר, תאים ללא קירות התא). ארבידופסיס thaliana עלה prooplasts mesophyll הם הסוג העיקרי של תא עלה. Protoplasts מבודד לאפשר גישה אופטימלית של אור UV לתאים. סוג תא זה יכול לשמש מבחני כי transiently להביע חלבונים אפיון פונקציונלי 40 , 41 . יתר על כן, Protoplasting הוחל על סוגים אחרים של תאים צמחיים ומינים 42 , 43 , 44 ( למשל, Petersson et al ., 2009; Bargmann and Birnbaum, 2010, ו- Hong et al , 2012).
<P class = "jove_content"> השיטה כוללת סך של 11 צעדים ( איור 1 א ). ארבידופסיס protoplasts mesophyll עלה מבודדים הראשון (שלב 1) והם לאחר מכן UV מוקרן ליצירת mRNPs crosslinked (שלב 2). כאשר protoplasts lysed תחת תנאי denaturing (שלב 3), mRNPs crosslinked משתחררים במאגר תמוגה / מחייב ומשוך למטה על ידי אוליגו d (T) 25 חרוזים (שלב 4). לאחר מספר סיבובים של שוטף מחמירים, mRNPs הם מטוהרים עוד ניתח. פפטידים denatured של mRBPs מתעכלים על ידי K proteinase לפני mRNAs crosslinked הם מטוהרים ואת איכות ה- RNA מאומת על ידי qRT-PCR (שלבים 5 ו -6). לאחר טיפול RNase וריכוז חלבון (שלב 7), איכות החלבון נשלטת על ידי SDS polyacrylamide ג'ל אלקטרופורזה (SDS-PAGE) ואת מכתים כסף (שלב 8). ההבדל בין דפוסי הלהקה חלבון יכול בקלות להיות דמיינו בין מדגם crosslinked (CL) ומדגם לא crosslinked (לא CL;מדגם השליטה השלילי מ protoplasts כי אינו חשוף קרינה UV). זיהוי החלבונים מושגת באמצעות proteomics MS מבוססי. החלבונים מן המדגם CL מופרדים על ידי חד מימדי polyacrylamide ג'ל אלקטרופורזה (1D-PAGE) כדי להסיר זיהום רקע אפשרי, הם "בתוך ג 'ל מתעכל" לתוך פפטידים קצרים באמצעות טריפסין, והם מטוהרים (שלב 9). ננו בשלב ההפוך כרומטוגרפיה נוזלית מצמידים ספקטרומטריית מסה (ננו LC-MS) מאפשר קביעת כמות של חלבונים סופי של פרוטאומה כבול mRNA (שלב 10). לבסוף, mRBPs מזוהים מאופיינים וקטלג באמצעות ניתוח ביואינפורמאטי (שלב 11).Protocol
Representative Results
Discussion
אנו בהצלחה להחיל mRNA אינטראקציה ללכוד, שפותח עבור שמרים ותאי אדם, לשתול protoplasts mesophyll עלה. תאים עלה mesophyll הם הסוג העיקרי של רקמת הקרקע עלים צמח. היתרון העיקרי של שיטה זו היא כי היא משתמשת vivo crosslinking לגלות את החלבונים מסביבה פיזיולוגית.
<p class="jove_content" style=";text-align:right;directi…Declarações
The authors have nothing to disclose.
Acknowledgements
אנו מכירים במעבדה של פרופ 'יוריס וינדריקס, שסיפק את המנגנון crosslinking UV מצויד מנורת UV קונבנציונאלי. KG נתמך על ידי קרן מחקר KU Leuven ומכיר תמיכה של FWO להעניק G065713N.
Materials
| REAGENTS | |||
| 0.8 M Mannitol | Sigma | M1902-500G | Primary isotonic Enzyme solution & MMg solution |
| 2M KCl | MERCK | Art. 4935 | Primary isotonic Enzyme solution & W5 buffer |
| 0.2 M MES (pH 5.7) (4-morpholineethanesulfonic acid) |
Sigma-aldrich | M2933 | Primary isotonic Enzyme solution, W5 buffer & MMg solution, Filtration sterilization |
| Cellulase R10 | Yakult Pharmaceutical Industry Co., Ltd. | CELLULASE “ONOZUKA” R-10, 10 g |
Final isotonic enzyme solution |
| Macerozyme R10 | Yakult Pharmaceutical Industry Co., Ltd. | MACEROZYME R-10, 10g | Final isotonic enzyme solution |
| 10% (w/v) BSA (Bovine Serum Albumin) |
Sigma-aldrich | A7906-100G | Final isotonic enzyme solution & Filtration sterilization |
| 1M CaCl2 | Chem-Lab NV | CL00.0317.1000 | Final isotonic enzyme solution, W5 buffer & Digestion buffer |
| 1M NaCl | Fisher Chemical | S/3160/60 | W5 buffer |
| 2M MgCl2 | Sigma | M8266-100G | MMg solution |
| 1M LiCl (Lithium Chloride) |
Acros | 199885000 | Lysis/binding buffer, Wash buffer 1, Wash buffer 2 & Low salt buffer |
| 5% (w/v) LiDS (Lithium Dodecyl Sulphate) |
Sigma-aldrich | L4632-25G | Lysis/binding buffer, Wash buffer 1 & Filtration sterilization |
| 1M DTT (Dithiothreitol) |
Thermo Fisher Scientific Wash buffer 1 & Wash buffer 2 |
307866 | Lysis/binding buffer, |
| 1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) | Acros & Fisher Chemical |
167620010 & H/1200/PB15 |
Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer |
| 0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) | Sigma-aldrich | ED-500G | Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer |
| Tween 20 | MERCK | 8.22184.0500 | Regeneration of oligo-d(T)25 beads |
| 0.1 M NaOH | VWR PROLABO CHEMICALS | 28244.295 | Regeneration of oligo-d(T)25 beads |
| 1X PBS (pH 7.4) (Phosphate Buffered Saline) containing (NaCl; KCl; Na2HPO4; KH2PO4) |
Fisher Chemical, MERCK, Sigma-aldrich & SAFC |
S/3160/60, Art. 4935, 71640-250G & 60230 |
Regeneration of oligo-d(T)25 beads |
| Proteinase K solution (2 μg/μL) | Thermo Fisher Scientific | 11789020 | Protein digestion |
| Loading dye | Invitrogen | LC5925 | SDS-PAGE |
| qPCR master mix | Promega | A6001 | qRT-PCR assay |
| RNase Cocktail | Thermo Fisher Scientific | AM2286 | RNA digestion |
| Methanol | Sigma-aldrich | 322415 | Gel fixation and gel destaining |
| Acetic acid | Sigma-aldrich | 537020 | Gel fixation and gel destaining |
| Coomassie Brilliant Blue R-250 | Thermo Fisher Scientific | 20278 | Gel staining |
| 1M NH4HCO3 (Ammonium bicarbonate) |
Sigma-aldrich | 09830-500G | Gel hydration & Digestion buffer |
| CH3CN (Acetonitrile) |
Sigma-aldrich | 34851-100ML | Gel dehydration & Peptide dissolving solution |
| IAA (Iodoacetic acid) |
Sigma-aldrich | I4386-10G | Alkylating agent |
| TFA (Trifluoroacetic acid) |
Sigma-aldrich | 302031-10X1ML | Peptide dissolving solution |
| FA (Formic acid) |
Sigma-aldrich | 06554-5G | Peptide extraction |
| Trypsin solution (6 ng/μL) | Promega | V5280 | Digestion buffer |
| Name | Company | Catalog Number | Comments |
| EQUIPMENT | |||
| Soil | Peltracom | LP2D | Plant growth |
| Vermiculite 3 | Sibli AS | 05VERMICULIET | Plant growth |
| Petri dish (150 x 20 mm) | Sarstedt | 82.1184.500 | Carrier for protoplast suspension |
| 0.22 μm filter | Millipore | SE2M229104 | Homogenization of final isotonic enzyme solution |
| Razorblade | Agar Scientific | T585 | Rosette leaf strips |
| 35-75 μm nylon mesh | SEFAR NITEX | 74010 | Protoplast suspension filtration |
| 50 mL round bottom tubes | Sigma-aldrich | T1918-10EA | Carrier for protoplast suspension |
| Hemocytometer (Bürker hemocytometer) |
MARIENFELD | 650030 | Protoplast cell counting |
| UV crosslinking apparatus (HL-2000 HybriLinker) |
UVP, LLC | UVP95003101 | in vivo UV crosslinking |
| UV lamp (Sankyo-Denki G8T5) |
SANKYO DENKI |
SD G8T5 | in vivo UV crosslinking |
| 50 mL glass syringe | FORTUNA Optima | Z314560 | Homogenization of protoplast lysate |
| Narrow needle (0.9 x 25 mm) | Becton Dickinson microlance 3 | 2021-04 | Homogenization of protoplast lysate |
| Rotator Model L26 | Labinco BV | 26110912 | Sample incubation by rotating |
| Oligo-d(T)25 magnetic beads (5 mg/mL) |
New England BioLabs | S1419S | mRNPs and mRNAs binding and pull-down |
| Magnetic rack | Invitrogen | CS15000 | mRNPs and mRNAs binding and pull-down |
| Centrifugal filter units (Amicon Ultra-4 centrifugal filter units) |
EMD Millipore | UFC800308 | mRBP concentration |
| Pierce Silver Stain Kit | Thermo Fisher Scientific | 24612 | Silver-staining assay |
| RNA purification kit (InviTrap Spin Plant RNA Mini Kit) |
STRATEC Molecular | 1064100300 | RNA purification |
| Spectrophotometer device (NanoDrop 1000 Spectrophotometer) | Thermo Fisher Scientific | ND-1000 | RNA quality and quantity |
| Real-Time PCR cycler (StepOne Real-Time PCR cycler) |
Thermo Fisher Scientific | 4376600 | cDNA quantification |
| µ-C18 columns (Millipore Zip Tip µ-C18 columns) |
Sigma-aldrich | 720046-960EA | Peptide purification |
| Mass spectrometer (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer) |
Thermo Fisher Scientific | IQLAAEGAAPFALGMAZR | Mass spectrometry-based proteomics |
| Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) | Thermo Fisher Scientific | ULTIM3000RSLCNANO | Mass spectrometry-based proteomics |
| C18 column (Easy Spray Pepmap RSLC C18 column) |
Thermo Fisher Scientific | ES800 | Mass spectrometry-based proteomics |
| C18 precolumn (Acclaim Pepmap 100 C18 precolumn) |
Thermo Fisher Scientific | 160321 | Mass spectrometry-based proteomics |
| Name | Company | Catalog Number | Comments |
| Primers for qRT-PCR assay | Sequences | ||
| UBQ10 mRNA (Li et al., 2014) |
Fw: AACTTTGGTGGTTTGTGTTTTGG Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA |
||
| 18S rRNA (Durut et al., 2014) |
Fw: CGTAGTTGAACCTTGGGATG Rv: CACGACCCGGCCAATTA |
||
Referências
- Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16 (9), 533-544 (2015).
- Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582 (14), 1977-1986 (2008).
- Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15 (12), 829-845 (2014).
- Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272 (43), 27274-27280 (1997).
- Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98 (6), 835-845 (1999).
- Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280 (15), 15340-15347 (2005).
- Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33 (22), 7074-7089 (2005).
- Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105 (40), 15317-15322 (2008).
- Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54 (5), 887-900 (2014).
- Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, D301-D308 (2011).
- Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13 (2), 77-83 (2012).
- Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261 (8), 3512-3518 (1986).
- Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16 (9), 323-326 (1991).
- Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8 (3), 491-500 (2013).
- Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270 (6), 2755-2763 (1995).
- Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35 (8), 423-426 (2010).
- Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39 (8), 674-679 (2012).
- Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46 (5), 674-690 (2012).
- Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149 (6), 1393-1406 (2012).
- Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20 (9), 1122-1130 (2013).
- Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20 (1), 127-133 (2013).
- Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6 (10127), 1-9 (2015).
- Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14 (8), 443-453 (2009).
- Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22 (12), 3142-3152 (2003).
- Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16 (3), 731-740 (2004).
- Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18 (2), 203-213 (2010).
- Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
- Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9 (3), e1002986 (2013).
- Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356 (1415), 1755-1759 (2001).
- Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77 (22), 7265-7273 (2005).
- Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56 (421), 3007-3016 (2005).
- Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224 (4), 900-914 (2006).
- Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59 (3), 633-644 (2008).
- Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29 (1), 125-134 (2011).
- Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30 (3), 623-635 (2002).
- Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
- Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77 (4), 964-973 (2005).
- Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6 (29766), 1-13 (2016).
- Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28 (10), 2435-2452 (2016).
- Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2 (7), 1565-1572 (2007).
- Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
- Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21 (6), 1659-1668 (2009).
- Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
- Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55 (5), 390-397 (2012).
- Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7 (3), 570-572 (2014).
- Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26 (3), 1330-1344 (2014).
- Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3 (3), 697-716 (2005).
- Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10 (7), 2930-2936 (2011).
- Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11 (4), 010587 (2012).
- Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12 (42), 1-12 (2016).
- Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25 (7), 864-876 (2015).
- Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21 (3), 163-182 (2002).
- Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7 (458), 1-13 (2011).
- Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5 (11), 976-989 (1994).
- Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20 (18), 3551-3567 (1999).
