JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Resultados
Discussion
Declarações
Acknowledgements
Materials
Referências
Tadução automática
Please note that all translations are automatically generated. Click here for the English version.
Bioquímica

MRNA संयंत्र Protoplasts से इंटरैक्टियम कैद

Published: July 28, 2017
doi:
10.3791/56011
, , ,
1Department of Biology,KU Leuven

Summary

यहां, हम अरबिडोप्सिस थलियाना के पत्थरों मेसोफिल प्रोटॉप्लेट्स के लिए एक इंटरैक्टिम कैप्चर प्रोटोकॉल पेश करते हैं। यह विधि गंभीर रूप से विवो यूवी क्रॉटलिंकिंग में निर्भर करती है और एक शारीरिक वातावरण से संयंत्र एमआरएनए-बाइंडिंग प्रोटीन की अलगाव और पहचान की अनुमति देती है।

Abstract

आरएनए बाध्यकारी प्रोटीन (आरबीपी) आरएनए के भाग्य का निर्धारण करते हैं। वे सभी आरएनए जैवनेसिस रास्ते में भाग लेते हैं और विशेष रूप से मैसेंजर आरएनए (एमआरएनए) के पोस्ट ट्रांसक्रिप्शनल जीन विनियमन (पीटीआरआर) में योगदान करते हैं। पिछले कुछ सालों में, खमीर और स्तनधारी सेल लाइनों से कई एमआरएनए-बाध्य प्रोटीओम को "एमआरएनए इंटरैक्टिम कैप्चर" नामक एक उपन्यास विधि के उपयोग से सफलतापूर्वक अलग किया गया है, जो एमआरएनए बाध्यकारी प्रोटीन (एमआरबीपी) की पहचान के लिए अनुमति देता है सीधे एक शारीरिक पर्यावरण से विधि ओलिगो (डीटी) मोती द्वारा विवो अल्ट्रावियोलेट (यूवी) क्रॉस लिंकींग, पुल डाउन और मैसेंजर रिबन्यूक्लोप्रोटीन कॉम्प्लेक्स (एमआरएनपी) की शुद्धि में बनायी गयी है, और मास स्पेक्ट्रोमेट्री (एमएस) द्वारा क्रॉस्लेन्क्क्ड प्रोटीन की बाद की पहचान। बहुत हाल ही में, एक ही विधि लागू करने से, कई पौधे एमआरएनए-बाध्य प्रोट्योम को विभिन्न अरबिडोप्सिस ऊतक स्रोतों से एक साथ सूचित किया गया है: एटिलाटेड रोपाई, पत्ती के ऊतक,पत्ती मेसोफिल प्रोटॉप्लेट्स, और सुसंस्कृत रूट कोशिकाएं। यहां, हम अरबीडोपिस थेलियाना पत्ती मेसोफिल प्रोटॉप्लेट्स के लिए अनुकूलित मॉरेनेट इंटरैक्टिम कैप्चर विधि पेश करते हैं, एक सेल प्रकार जो प्रयोगों के लिए बहुमुखी उपकरण के रूप में कार्य करता है जिसमें विभिन्न सेलुलर एशेज शामिल हैं। इष्टतम प्रोटीन उपज के लिए स्थितियों में ऊतक शुरू करने की मात्रा और यूवी विकिरण की अवधि शामिल है। एक माध्यम-स्तरीय प्रयोग (10 7 कोशिकाओं) से प्राप्त एमआरएनए-बाध्य प्रोटीम में, आरबीपी ने आरएनए बाध्यकारी क्षमता को अधिक से अधिक प्रतिनिधित्व किया है, और कई उपन्यास आरबीपी की पहचान की गई थी। प्रयोग को बढ़ाया जा सकता है (10 9 कोशिका), और पौधों में एमआरएनए-बाध्य प्रोटीयोम को मोटे तौर पर अलग, कैटलॉग और तुलना करने के लिए अन्य पौधों के प्रकार और प्रजातियों के लिए अनुकूलित विधि लागू की जा सकती है।

Introduction

सेलुलर जैविक प्रक्रियाओं को बनाए रखने के लिए यूकेरियोट्स कई आरएनए जैवनेसिस नियामक रास्ते का उपयोग करते हैं। ज्ञात प्रकार के आरएनए में, एमआरएनए बहुत विविधतापूर्ण है और प्रोटीन की कोडिंग क्षमता और उनके आईसोफॉर्म 1 को लेता है। पीटीजीआर मार्ग पूर्व-एमआरएनए 2 , 3 के भाग्य को निर्देशित करता है। विभिन्न जीन परिवारों के आरबीपी आरएनए के नियमन को नियंत्रित करते हैं, और पीटीआरआर में, प्रत्यक्ष एमआरबीपीएस गाइड एमआरएनए प्रत्यक्ष शारीरिक बातचीत के माध्यम से, कार्यात्मक एमआरएनपी बनाने इसलिए, की पहचान करने और mRBPs की विशेषताओं और उनके mRNPs पिछले तीन दशकों .over सेलुलर mRNA चयापचय 2 के नियमन को समझने के लिए महत्वपूर्ण है, विभिन्न इन विट्रो तरीकों – आरएनए electrophoretic गतिशीलता पारी (REMSA) assays, घातीय संवर्धन संसाधनों द्वारा लाइगैंडों के व्यवस्थित विकास सहित (SELEX) लाइब्रेरी-व्युत्पन्न संरचनाओं, आरएनए बाइंड-एन-सैक (आरबीएनएस), रेडियोलैलेब्ड या मात्रात्मक पर आधारितप्रतिदीप्ति आरएनए बाध्यकारी assays, एक्सरे क्रिस्टलोग्राफी, और एनएमआर स्पेक्ट्रोस्कोपी 4 , 5 , 6 , 7 , 8 , 9 – आरबीपी के अध्ययन के लिए व्यापक रूप से लागू किया गया है, मुख्य रूप से स्तनधारी कोशिकाओं से। स्तनधारी आरबीपी के इन अध्ययनों के परिणाम आरएनए बाध्यकारी प्रोटीन डाटाबेस (आरबीपीडीबी) के माध्यम से खोजा जा सकते हैं, जो प्रकाशित टिप्पणियों 10 इकट्ठा करता है

हालांकि इन इन विट्रो तरीकों में शक्तिशाली उपकरण हैं, वे अनुक्रमों के दिए गए आरएनए पूल से बाध्य आरएनए प्रारूपों का निर्धारण करते हैं और इसलिए उन्हें नए लक्ष्य आरएनए को खोजने की क्षमता में सीमित हैं। जीनोम चौड़ा आरबीपी की भविष्यवाणी करने के लिए कम्प्यूटेशनल रणनीतियों के लिए भी यही सच है, जो प्रोटीन अनुक्रम और संरचना 15 के संरक्षण पर आधारित हैं। इस पर काबू पाने के लिए, एक नया प्रयोगात्मक विधि हास्थापित किया गया है जो कि आरएनए के रूपांकनों की पहचान के लिए अनुमति देता है, जो कि आरबीपी की दिलचस्पी के साथ संपर्क करता है, साथ ही बाध्यकारी के सटीक स्थान के निर्धारण के लिए। "क्रॉसलिंकिंग एंड इम्युनोपेरेग्रेशन" (CLIP) नामक इस विधि को विवो यूवी क्रॉस्लिंकिंग में शामिल किया गया है, जिसके बाद इम्यूनोपेरेग्रेशन 11 प्रारंभिक अध्ययनों से पता चला है कि डीएनए और आरएनए न्यूक्लियोटाइड्स का फोटो एक्टिवेशन 245 एनएम से अधिक उत्तेजना यूवी तरंग दैर्ध्य पर हो सकता है। थिइमिडीन के माध्यम से प्रतिक्रिया को पसंद किया जा रहा है (कमी हुई फोटोरैक्टिविटी के क्रम में: डीटी ≥ डीसी> आरयू> आरसी, डीए, डीजी) 12 254 एनएम (यूवी-सी) की तरंग दैर्ध्य के साथ यूवी प्रकाश का उपयोग करना, यह पाया गया कि आरएनए न्यूक्लियोटाइड्स और प्रोटीन अवशेषों के बीच सहसंयोजक बंधन बनते हैं, जब केवल कुछ अंगस्ट्रम्स (ए) की सीमा में। इस घटना को आरएनए और आरबीपी की "शून्य-लंबाई" क्रॉस्लिंकिंग कहा जाता है। यह एक कड़े शुद्धि प्रक्रिया द्वारा पीछा किया जा सकता है थोड़ा पृष्ठभूमि 13 , 14 के साथ सावधान।

CLB के लिए पूरक एक रणनीति आरबीपी के परिदृश्य का वर्णन करने के लिए प्रोटीन की पहचान के साथ विवो यूवी क्रॉटलिंकिंग में संयोजित है। इस तरह के जीनोम चौड़ा एमआरएनए-बाध्य प्रोटीओम्स को खमीर कोशिकाओं, भ्रूण स्टेम कोशिकाओं (ईएससी) और मानव कोशिका लाइनों ( यानी, हेके 2 9 3 और हेला) से इस उपन्यास प्रयोगात्मक दृष्टिकोण का उपयोग किया गया है, जिसे "एमआरएनए इंटरैक्टिम कैप्चर" कहा जाता है , 18 , 19 , 20 , 21 विधि vivo यूवी crosslinking में एमआरएनपी शुद्धि और एमएस आधारित प्रोटिओमिक्स के बाद से बना है। इस रणनीति को लागू करने से, कई उपन्यास "चाँदनीकरण" वाले आरबीपी जिनमें गैर-कैनोनिकल आरबीडी शामिल हैं, और यह स्पष्ट हो गया है कि अधिक प्रोटीन को आरएएन-बाध्यकारी क्षमता में पहले से माना जाता है"> 15 , 16 , 17. इस पद्धति का उपयोग आरबीपी की जांच करते समय नए अनुप्रयोगों और नए जैविक सवालों के जवाब देने की क्षमता के लिए देता है। उदाहरण के लिए, हाल ही के एक अध्ययन में एमआरएनए-बाईड प्रोटेम (कोर आरबीपी प्रोटीम) खमीर और मानव कोशिकाओं के बीच 22

संयंत्र आरबीपी पहले से ही विकास और विकास ( जैसे , फूलों के समय के बाद ट्रांसक्रिप्शनल नियमन में, सर्कडियन घड़ी, और मिटोकोंड्रिया और क्लोरोप्लास्ट में जीन की अभिव्यक्ति) में शामिल पाया गया है 24 , 25 , 26 , 27 , 28 , 29 । इसके अलावा, वे सेल्युलर प्रक्रियाओं में अबायटीक तनाव ( जैसे, ठंड, सूखा, साललिता, और फरसीक एसिड (एबीए)) 31 , 32 , 33 , 34 आरएएनए मान्यता मोटीफ (आरआरएम) और के समरूपता (केएच) डोमेन अनुक्रम रूपांकनों पर आधारित अरबीडॉप्सिस थेलियाना जीनोम में 200 से अधिक पूर्वानुमानित आरबीपी जीन हैं; चावल में, लगभग 250 को नोट किया गया 35 , 36 यह उल्लेखनीय है कि कई भविष्यवाणियां आरबीपी पौधों के लिए अद्वितीय लगती हैं ( उदाहरण के लिए आरआरएम डोमेन वाले 50% पूर्वानुमानित अरबिडोप्सिस आरबीपी के लिए मेटाजोन ऑर्थोलॉजीज नहीं) 35 , यह सुझाव देते हुए कि कई नए फ़ंक्शन बना सकते हैं सबसे अनुमानित आरबीपी के कार्यों में 23 वर्णों का अभाव है।

अरबीपोप्सिस से युक्त बीआरएनए-बाध्य प्रोटीओमों का अलगाव, पर्ण ऊतक, सुसंस्कृत जड़ कोशिकाओं, और पत्ती मेसोफिल प्रोटॉप्लेट्स के उपयोग के माध्यम सेएमआरएनए इंटरैक्टिम कैप्चर हाल ही में 38 , 39 की सूचना मिली है। ये अध्ययन निकट भविष्य में पौधों में कार्यात्मक आरबीपी व्यवस्थित रूप से सूचीबद्ध करने की मजबूत क्षमता का प्रदर्शन करते हैं। यहां, हम पौधे के प्रोटॉप्लेट्स से एमआरएनए इंटरैक्टिम कैप्चर के लिए एक प्रोटोकॉल पेश करते हैं ( यानी सेल की दीवारों के बिना कोशिकाएं)। अरबिडोप्सिस थलियाना लीफ मेसोफिल प्रोटॉप्लेट्स लीफ सेल का मुख्य प्रकार है। पृथक प्रोटॉप्लास्ट्स कोशिकाओं को यूवी प्रकाश की इष्टतम पहुंच प्रदान करते हैं। इस सेल प्रकार का उपयोग एनासन में किया जा सकता है जो कि क्रियाशील लक्षण वर्णन 40 , 41 के लिए ट्रांजिस्टर प्रोटीन व्यक्त करता है। इसके अलावा, कई अन्य वनस्पति कोशिका प्रकारों और प्रजातियों 42 , 43 , 44 ( उदाहरण के लिए, पीटरसन एट अल ।, 200 9, बर्गमैन और बिरनबाम, 2010 और हांग एट अल ।, 2012) के लिए प्रोटोप्पन लागू किया गया है।

<P वर्ग = "jove_content"> इस पद्धति में कुल 11 चरणों ( चित्रा 1 ए ) शामिल हैं। अरबिडोप्सिस लीफ मेसोफिल प्रोटॉप्लेट्स पहले पृथक (चरण 1) हैं और बाद में यूवी को क्रॉस्लेन्क्ड एमआरएनपी (चरण 2) बनाने के लिए विकिरण किया गया है। जब प्रोटोप्लास्ट्स को झुकाने वाली स्थिति (चरण 3) के तहत लिपिक किया जाता है, तो क्रॉस्लेन्क्क्ड एमआरएनपी को लिसन / बाइंडिंग बफर में रिलीज़ किया जाता है और ओलिगो-डी (टी) 25 मोती (चरण 4) से नीचे खींच लिया जाता है। कठोर washes के कई दौर के बाद, एमआरएनपी शुद्ध कर रहे हैं और आगे का विश्लेषण किया। एमआरबीपी के विकृत पेप्टाइड्स को प्रोटीनेस के द्वारा पचाने से पहले क्रॉर्लिंक किए गए एमआरएनए शुद्ध होते हैं और आरआरए की गुणवत्ता QRT-PCR (चरण 5 और 6) द्वारा सत्यापित की जाती है। आरएनज उपचार और प्रोटीन एकाग्रता (चरण 7) के बाद, प्रोटीन की गुणवत्ता को एसडीएस पॉलीएक्लाइमाइड जेल वैद्युतोसोरिसिस (एसडीएस पृष्ठ) और चांदी की धुंधला (चरण 8) द्वारा नियंत्रित किया जाता है। प्रोटीन बैंड पैटर्न में अंतर आसानी से एक क्रॉस-लिंक्ड नमूना (सीएल) और एक गैर-क्रॉस्लेन्क्स्क्ड नमूना (गैर-सीएल;प्रोटॉप्लेट्स से नकारात्मक नियंत्रण नमूना जो कि यूवी विकिरण के अधीन नहीं है)। प्रोटीन की पहचान एमएस आधारित प्रोटिओमिक्स के माध्यम से प्राप्त की जाती है। सीएल के नमूने से प्रोटीन एक-आयामी polyacrylamide जेल वैद्युतकणसंचलन (1 डी पृष्ठ) से संभव पृष्ठभूमि प्रदूषण को दूर करने के लिए अलग-अलग पेप्टाइड्स में ट्रिप्सिन का उपयोग कर "इन-जेल पचास्ट" होते हैं, और शुद्ध (चरण 9) हैं। माइन स्पेक्ट्रोमेट्री (नैनो-एलसी-एमएस) के साथ मिलकर नैनो रिवर्स-चरण तरल क्रोमैटोग्राफी, एमआरएनए-बाईड प्रोटीम (चरण 10) में निश्चित प्रोटीन की मात्रा के निर्धारण के लिए अनुमति देता है। अंत में, पहचान की गई एमआरबीपी को जैवइन्फोर्मेटिक विश्लेषण (चरण 11) का उपयोग करके वर्णित किया गया है।

Protocol

1. अरबिडोप्सिस लीफ मेसोफिल प्रोप्लेस्टास्ट अलगाव नोट: एयूबीडोपिस लीफ मेसोफिल प्रोटेप्लास्ट्स मूल रूप से अलग हैं जैसा कि यू एट अल ।, 2007 द्वारा वर्णित है, कई संशोधनों के साथ 40 …

Representative Results

हमने एक विशेषता हेलो, जो कि सैल नमूने में मनका गोली से चारों ओर, वॉश बफर 2 ( चित्रा 1 बी ) के साथ धोने के चरण 4.3 में देखा। यद्यपि इसकी जांच नहीं हुई है, इस घटना को संभवतः चुंबकीय कैप्चर क?…

Discussion

हमने सफलतापूर्वक एमआरएनए इंटरैक्टिम कैप्चर को लागू किया, जो कि खमीर और मानव कोशिकाओं के लिए विकसित किया गया था, पौधे पत्ती मेसोफिल प्रोटॉप्लेट्स। लीफ मेसोफिल कोशिका पौधे के पत्तों में प्रमुख प्रकार ?…

Declarações

The authors have nothing to disclose.

Acknowledgements

हम प्रोफेसर जोरीस वंडरिक्क्स की प्रयोगशाला को स्वीकार करते हैं, जिन्होंने पारंपरिक यूवी दीपक से लैस यूवी क्रॉसलिंकिंग उपकरण प्रदान किया था। केजी ल्यूवेन अनुसंधान फंड द्वारा समर्थित है और एफडब्ल्यूओ अनुदान G065713N से समर्थन स्वीकार करता है।

Materials

REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)		 Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g		 Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)		 Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1M NaCl Fisher Chemical S/3160/60 W5 buffer
2M MgCl2 Sigma M8266-100G MMg solution
1M LiCl
(Lithium Chloride)		 Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)		 Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1M DTT
(Dithiothreitol)		 Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2		 307866 Lysis/binding buffer,
1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical		 167620010 &
H/1200/PB15		 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1X PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)		 Fisher Chemical, MERCK,
Sigma-aldrich & SAFC		 S/3160/60,
Art. 4935,
71640-250G &
60230		 Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1M NH4HCO3
(Ammonium bicarbonate)
 		 Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)		 Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)		 Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)		 Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)		 Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)		 MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)		 UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)		 SANKYO
DENKI		 SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)		 New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)		 EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)		 STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)		 Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)		 Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)		 Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)		 Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)		 Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)		 Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)		 Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA
DOWNLOAD MATERIALS LIST

Referências

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16 (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582 (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15 (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272 (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98 (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280 (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33 (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105 (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54 (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13 (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261 (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16 (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8 (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270 (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35 (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39 (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46 (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149 (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20 (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20 (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6 (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14 (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22 (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16 (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18 (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9 (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356 (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77 (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56 (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224 (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59 (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29 (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30 (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77 (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6 (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28 (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2 (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21 (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55 (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7 (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26 (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3 (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10 (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11 (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12 (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25 (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21 (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7 (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5 (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20 (18), 3551-3567 (1999).

Tags

Keywords: MRNA InteractomeMRNA-bound ProteomePlant ProtoplastsPost-transcriptional Gene RegulationUV CrosslinkingArabidopsis ThalianaLeaf Mesophyll ProtoplastsMMG SolutionCentrifugation
check_url/pt/56011?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citar este artigo
Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).
Baixar citação
Reimpressões e Permissões

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image