참조되지 않은 태평양 굴에서 사실상 순차적 cDNA 라이브러리 생성을 위한 수렴 전략
Summary
우리는 참조되지 않은 태평양 굴 견본에서 RNA 견본을 사용하는 방법에 대한 전략을 기술하고, 사실상 연속된 cDNA 라이브러리를 생성하기 위하여 공개적으로 유효한 게놈 데이터와 비교하여 유전 물질을 평가합니다.
Abstract
새로운 세포주 또는 게놈 시퀀싱 프로젝트의 개발과 같은 주요 실험에서 이전에 사용되었던 기준 종의 생물학적 물질에 대한 접근은 종종 추가 연구 또는 제3자에 대한 제공이 어렵습니다. 샘플의 소모적 특성. 현재 아시아, 오스트레일리아 및 북미의 태평양 연안에 널리 분포되어 있지만, 개별 태평양 굴 표본은 유전적으로 매우 다양하므로 유전자 라이브러리의 시작 물질로 직접 적합하지 않습니다. 이 기사에서는 지역 해산물 시장에서 얻은 참조되지 않은 태평양 굴 표본을 사용하여 cDNA 라이브러리를 생성하는 방법을 보여줍니다. 이들 라이브러리는 공론화된 굴 게놈과 비교하였고, 가장 가까운 관련 라이브러리는 미토콘드리아 기준 유전자 시토크롬 C 옥시다아제 소단위 I(COX1) 및 NADH 탈수소효소(ND)를 사용하여 선택하였다. 생성된 cDNA 라이브러리의 적합성은 UDP-글루쿠로닉 산 탈수소효소(UGD) 및 UDP-자일로스의 생합성을 담당하는 UDP-자일로오스 신타제(UXS)를 코딩하는 두 유전자의 복제 및 발현에 의해 입증된다. UDP-포도당.
Introduction
긴 납품 시간, 기업가 추론 또는 국가별 관세 규정으로 인해 살아있는 참조 생물학적 물질의 취득이 어려울 수 있습니다. 대안으로서, 요구되는 생물학적 물질은 또한 전형적으로 동일한 시편으로부터 수집될 수 있다. 그러나, 이 견본은 유전자형의 수준에 현저하게 변화할 수 있고, 그러므로 동일 종의 디지털로 저장된 기준 게놈과의 비교는 수시로 새로 공급된 물자의 비호환성 때문에 어렵거나 심지어 쓸모없는 렌더링됩니다 기존 DNA 증폭 방법. 개별 시료의 고도로 보존된 유전자를 시퀀싱하는 것은 cDNA라이브러리 2의 품질 평가를 위한 기준 유전자로 자주 사용되는 보존된 미토콘드리아 유전자와 같은 종 1을 식별하기 위한 널리 사용되고 강력한 도구입니다2 ,3,4,5,6. 본명 제시된 방법에 대한 근본적인 근거는 기준 게놈의 상응하는 서열에 비해 개별 익명 굴 샘플에서 미토콘드리아 유전자 서열의 높은 보존이 다른 유전자도 나타낼 수 있음을 나타낸다는 것이다. 낮은 수준의 차이는 핵 DNA 7에 비해 일반적으로 빠른 미토콘드리아DNA 진화 속도를 감안할 때, 단순히 공개적으로 사용하여 광범위한 과학적 및 산업적으로 관련된 유전자의 증폭 및 격리를 허용합니다. 사용 가능한 시퀀싱 데이터를 참조로 사용할 수 있습니다.
본 명세서의 전체적인 목적은 굴 유전자의 복제를 위한 템플릿 DNA로서 사용될 수 있는 사실상 서열된 굴 cDNA 라이브러리를 생성하기 위한 최적화된 워크플로우를 제시하는 것이다. 가상 시퀀싱에서, 드 노보 게놈 시퀀싱은 우회; 대신, 알려진 디지털 방식으로 저장된 참조 시퀀스는 결국 라이브러리를 구성할 cdNA 생산을 위한 프라이머를 활용하거나 설계하는 데 직접 사용됩니다(또는 기존 라이브러리에 추가됨). 목표는 생성된 cDNA 서열과 기준 서열 사이의 유사성이 낮은 발산에서 높은 발산까지 순위가 매겨질 수 있음을 의미하는 수렴 cDNA 라이브러리를 생성하는 것입니다. 시토크롬 C 옥시다아제 소단위 1(COX1) 및 NADH 탈수소효소(ND)를 기준 유전자로 사용하는 주요 장점은 이러한 미토콘드리아 유전자의 높은 보존으로 인해 지리적으로 매우 탈수한 굴 표본도 프로파일화될 수 있다는 것입니다. 이러한 잘 확립 된 마커로 접근법을 입증 한 후, 우리는 설탕 뉴클레오티드 생합성에 관여하고 산업 관련성 8,9, 2 효소 후보에게 적용을 입증합니다. 10. 태평양 굴의 생명 공학 적 잠재력은 아직 밝혀지지 않았습니다. 따라서, 우리는 사실상 서열화된 cDNA 라이브러리를 준비하기 위한 이 수렴 방법이 또한 이 관련 생물학 물자에서 cDNA를 생성하고 싶은 비전문가 연구원을 위해 적법할 것이라는 점을 믿습니다.
Protocol
Representative Results
Discussion
제시된 프로토콜은 COX1과 ND 유전자를 공개적으로 이용 가능한 굴 DNA 게놈 데이터베이스와 비교하여 지역 해산물 시장에서 유사한 표현형을 가진 참조되지 않은 굴 표본의 유전 적 식별을 허용합니다. 이 방법의 중요성은 가상 cDNA 라이브러리의 평가를 위해 단일 PCR 반응만 필요하기 때문에 단순성입니다. 보존된 2개의 미토콘드리아 COX1 및 ND 유전자는 각 굴에서 RNA 추출물의 역전사에 의해 생성된…
Declarações
The authors have nothing to disclose.
Acknowledgements
이 작품은 중국 자연과학 재단(교부금 번호 31471703, A020130537 및 31671854, J.V. 및 L.L.에 31670435) 및 100 외국 인재 계획(JSB2014012)에 의해 부분적으로 지원되었습니다.
Materials
| Chemicals: | |||
| 1% Triton X-100 | Solarbio | 9002-93-1 | *Alternative distributors possible |
| 2,5-Dihydroxybenzoic acid | Alfa Aesar | 490-79-9 | *Alternative distributors possible |
| Acetonitrile | Merck | 75-05-8 | *Alternative distributors possible |
| Agarose for molecular biology | Biowest Chemicals | 111860 | *Alternative distributors possible |
| Ampicilin | Solarbio | 69-52-3 | *Alternative distributors possible |
| Chloroform | Lingfeng, Shanghai | 67-66-3 | *Alternative distributors possible |
| DEPC water | Thermo Scientific | R0601 | |
| Ethanol | Jinhuada, Guangzhou | 64-17-5 | *Alternative distributors possible |
| Guanidinium thiocyanate-phenol reagent | Invitrogen | 15596018 | TRIzol reagent |
| Imidazole | Energy Chemical | 288-32-4 | *Alternative distributors possible |
| Isopropyl alcohol | Nanjing Chemical Reagent | 67-63-0 | *Alternative distributors possible |
| Isopropyl β-D-thiogalactopyranoside | Solarbio | 367-93-1 | *Alternative distributors possible |
| Kanamycin | Solarbio | 25389-94-0 | *Alternative distributors possible |
| LB Agar | Thermo Fisher | 22700025 | *Alternative distributors possible |
| LB Broth | Thermo Fisher | 10855021 | *Alternative distributors possible |
| Methanol | Jinhuada, Guangzhou | 67-56-1 | *Alternative distributors possible |
| MgCl2 hexahydrate | Xilong Huagong | 7791-18-6 | *Alternative distributors possible |
| NaCl | Xilong Huagong | 7647-14-5 | *Alternative distributors possible |
| NAD+ | Duly Biotech | 53-84-9 | *Alternative distributors possible |
| Phenyl-methylsulfonyl fluoride | Macklin | 329-98-6 | *Alternative distributors possible |
| Tris | Solarbio | 77-86-1 | *Alternative distributors possible |
| UDP-glucose | Wuhu Nuowei Chemicals | 28053-08-9 | *Alternative distributors possible |
| UDP-glucuronic acid | SIGMA | 63700-19-6 | *Alternative distributors possible |
| Tools/Instruments: | |||
| MALDI-TOF mass spectrometer | Bruker | Autoflex | *Alternative distributors possible |
| Metal block heater | Long Yang Scientific Instruments | Thermoshaker HB20 | *Alternative distributors possible |
| PCR thermocycler | Hema | 9600 | *Alternative distributors possible |
| Enzyme and Kits: | |||
| 10×Ligation buffer | Thermo Scientific | B69 | *Alternative distributors possible |
| 5×PrimeSTAR buffer | Takara | 9158A | |
| Alkaline phosphatase | ThermoFisher FastAP | EF0654 | *Alternative distributors possible |
| COX forward primer | Genscript | ATGTCAACAAATCATTTAGACATTG | |
| COX reverse primer | Genscript | ACTTGACCAAAAACATAAGACATG | |
| Cutsmart Buffer | NEB | B7204S | *Alternative distributors possible |
| dNTP mix | Invitrogen | 18427088 | |
| MgUGD forward primer | Genscript | ACATATGACCCTGTCCAAGATCTGTTGT | |
| MgUGD reverse primer | Genscript | ACTCGAGACTCTGTGAGGCGGTGGAG | |
| MgUXS forward primer | Genscript | CCATATGGCAGAATCCTCACAATCAC | |
| MgUXS reverse primer | Genscript | ACTCGAGCACATTTTTGAATTTGCAGACGT | |
| ND forward primer | Genscript | ATGAGATGGCAATTATTTTTTAAT | |
| ND reverse primer | Genscript | ATGTATTTTGGAAAAATCTCCAC | |
| PCR Cleanup Kit | AxyGen | AP-PCR-250 | *Alternative distributors possible |
| pET-30a(+) vector | Merck Millipore | 69909 |
Referências
- Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359 (1444), 669-679 (2004).
- Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
- Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74 (5), 1546-1554 (2007).
- Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
- Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113 (35), 9834-9839 (2018).
- Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29 (6), 937-945 (2010).
- Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28 (2), 261-265 (2005).
- Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24 (8), 735-741 (2017).
- Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23 (12), 1103-1110 (2016).
- Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99 (22), 9463-9472 (2015).
- Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76 (2), 615-619 (1979).
- Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19 (6), 1600 (2018).
- Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128 (2), 215-227 (1972).
