Identificatie van voetafdrukken van RNA: eiwitcomplexen via RNA-immunoprecipitatie in tandem gevolgd door sequencing (RIPiT-SEQ)
Summary
Hier presenteren we een protocol om endogene RNA binding sites of “Footprints” van RNA: proteïne (RNP) complexen uit zoogdiercellen te verrijken. Deze aanpak omvat twee immunoprecipitaties van RNP-subeenheden en wordt daarom nagesynchroniseerde RNA-immunoprecipitatie in tandem (RIPiT).
Abstract
RNA-immunoprecipitatie in tandem (RIPiT) is een methode voor het verrijken van RNA-voetafdrukken van een paar eiwitten binnen een RNA: proteïne (RNP)-complex. RIPiT maakt gebruik van twee zuiveringsstappen. Ten eerste wordt immunoprecipitatie van een gelabelde RNP-subeenheid gevolgd door milde RNase-spijsvertering en daaropvolgende niet-denaturerende affiniteits elutie. Een tweede immunoprecipitatie van een andere RNP-subeenheid maakt verrijking van een gedefinieerd complex mogelijk. Na een denaturerende elutie van Rna’s en eiwitten worden de RNA-voetafdrukken omgezet in bibliotheken met een hoge doorvoer voor DNA-sequencing. In tegenstelling tot de meer populaire ultraviolet (UV) crosslinking gevolgd door immunoprecipitatie (clip) benadering om RBP binding sites te verrijken, ripit is UV-crosslinking onafhankelijk. Vandaar RIPiT kan worden toegepast op talrijke eiwitten aanwezig in het RNA interactome en daarbuiten die essentieel zijn voor RNA verordening, maar niet direct contact op met het RNA of UV-crosslink slecht om RNA. De twee zuiveringsstappen in RIPiT bieden een bijkomend voordeel van het identificeren van bindende locaties waar een eiwit van belang in samenwerking met een andere cofactor fungeert. De dubbele zuiverings strategie dient ook om het signaal te verbeteren door de achtergrond te beperken. Hier bieden we een stapsgewijze procedure voor het uitvoeren van RIPiT en het genereren van high-throughput sequencing-bibliotheken van geïsoleerde RNA-voetafdrukken. We schetsen ook de voordelen en toepassingen van RIPiT en bespreken enkele van de beperkingen.
Introduction
Binnen cellen bestaat RNA in complex met eiwitten om RNA te vormen: eiwitcomplexen (RNPs). RNPs worden geassembleerd rond RNA bindende eiwitten (RBPs, die direct binden RNA) maar ook bestaan uit niet-RBPs (die binden RBPs maar niet RNA), en zijn vaak dynamisch van aard. RBPs en hun cofactoren functioneren collectief binnen RNPs om regelgevende functies uit te voeren. Bijvoorbeeld, in de nonsens-gemedieerde mRNA Decay (NMD)-pathway herkennen de UPF-eiwitten (UPF1, UPF2 en UPF3b) het voortijdig beëindigde ribosome. Elk van de UPF eiwitten kan binden aan RNA, maar het is pas wanneer ze samen assembleren dat een actief NMD-complex begint te vormen. Binnen dit complex wordt UPF1 verder geactiveerd door fosforylering door een niet-RBP SMG1, en een dergelijke UPF1 activering leidt uiteindelijk tot de werving van mRNA Decay inducerende factoren1,2. In dit voorbeeld vereisen Rbp’s niet-RBP-cofactoren voor werving en activering van het RNP-complex dat NMD activeert. Nog een andere eigenschap van RNPs is hun compositorische heterogeniteit. Overweeg de spliceosome, die bestaat in verschillende E, A, B of C complexen. Verschillende spliceosoom complexen hebben overlappende en uitgesproken eiwitten3. Om RNP-functies te bestuderen, is het belangrijk om te verhelmaken welke Rna’s gebonden zijn aan een RBP en de bijbehorende eiwitten. Er zijn veel methoden om dit te bereiken, waarbij elke benadering zijn duidelijke voor-en nadelen heeft4,5,6,7.
De meest populaire methoden om RBP binding sites te identificeren-crosslinking gevolgd door immunoprecipitatie (clip) en de verschillende variaties-vertrouw op ultraviolet (UV) licht om een RBP te crosslinken naar RNA8. Echter, dit is niet een effectieve aanpak voor niet-RBPs binnen RNPs, die niet rechtstreeks contact opnemen met het RNA. Hier beschrijven we een alternatieve aanpak die van toepassing is op Rbp’s en niet-RBPs, om hun RNA binding-sites te isoleren en te identificeren. Deze aanpak genoemd RNA-immunoprecipitatie in tandem (ripit) bestaat uit twee immunoprecipitatie-stappen, die helpen bij het bereiken van een hogere specificiteit in vergelijking met een enkele zuivering (Figuur 1)9,10. Aangezien de individuele immunoprecipitatie (IP)-stappen met een lagere stringentie kunnen worden uitgevoerd in vergelijking met de clip, is ripit niet afhankelijk van de beschikbaarheid van antilichamen die de aanwezigheid van sterke detergenten tijdens immunoprecipatie kunnen weerstaan. Het meest unieke voordeel van RIPiT is de mogelijkheid om twee verschillende eiwitten te targeten in twee zuiveringsstappen; Dit biedt een krachtige manier om een compositioneel verschillend RNP-complex van andere vergelijkbare complexen11te verrijken.
Kleine variaties op de RIPiT-procedure kunnen de RNP-verrijking verder verbeteren. Sommige interacties van RNA-eiwit of eiwit-eiwit binnen RNPs zijn bijvoorbeeld van voorbijgaande aard en het kan moeilijk zijn om voetafdrukken van dergelijke complexen efficiënt te zuiveren. Om dergelijke interacties te stabiliseren, kan rnps worden gecrosslinkt in cellen met formaldehyde voorafgaand aan cel lysis en ripit. We hebben bijvoorbeeld geconstateerd dat een zwakke interactie tussen de kernfactor van Exon Junction (EJC), EIF4AIII en de disassemblage factor van EJC, PYM12 kan worden gestabiliseerd met een formaldehyde-behandeling, zodat meer RNA-voetafdrukken worden verrijkt (gegevens niet weergegeven). Voorafgaand aan de celoogst en de RIPiT, cellen kunnen ook worden behandeld met drugs te stabiliseren of te verrijken RNPs in een bepaalde staat. Bijvoorbeeld, bij het bestuderen van eiwitten die worden verwijderd uit mRNA tijdens de vertaling (bijvoorbeeld, de EJC13, UPF114), behandeling met Vertaal remmers zoals puromycine, haring of harringtonine kan leiden tot verhoogde bezetting van eiwitten op Rna’s.
De hoeveelheid RNA teruggewonnen uit RIPiT is meestal laag (0,5-10 pmollen, dat wil zeggen, 10-250 ng RNA gezien een gemiddelde RNA-lengte van 75 NT). De belangrijkste reden hiervoor is dat slechts een klein deel van een gegeven eiwit aanwezig is in complex met andere eiwitten binnen RNPs (elk “vrij” eiwit dat IP’ed in de eerste stap gaat verloren tijdens het tweede IP). Om RNA-SEQ-bibliotheken van dit RNA te genereren, schetsen we hier ook een aanpassing van het eerder gepubliceerde protocol dat geschikt is voor dergelijke lage RNA-ingangen15,16 (Figuur 2), die een high-throughput sequencing voorbereide samples in 3 oplevert Dagen.
Protocol
Representative Results
Discussion
We bespreken hier enkele belangrijke overwegingen om RIPiT succesvol uit te voeren. In de allereerste plaats moeten individuele IPs worden geoptimaliseerd om bij elke stap de hoogst mogelijke efficiëntie te bereiken. De hoeveelheid vlag agarose kralen voor het ingevoerde aantal cellen die hier worden beschreven, heeft bewezen robuust te zijn voor een breed scala aan eiwitten die we hebben getest. Aangezien slechts een kleine fractie van partner eiwitten co-immunoprecipitated is met het vlag eiwit, is de hoeveelheid anti…
Declarações
The authors have nothing to disclose.
Acknowledgements
Dit werk werd ondersteund door de NIH Grant GM120209 (GS). De auteurs danken de OSUCCC Genomics gedeelde bronnen kern voor hun diensten (CCC ondersteuning Grant NCI P30 CA16058).
Materials
| Anti-FLAG Affinity Gel | Sigma | A2220 | |
| ATP, [γ-32P]- 3000Ci/mmol 10mCi/ml EasyTide, 250µCi | PerkinElmer | BLU502A250UC | |
| BD Disposable Syringes with Luer-Lok Tips (200) | Fisher | 14-823-435 | |
| Betaine 5M | Sigma | B0300 | |
| biotin-dATP | TriLink | N-5002 | |
| biotin-dCTP | Perkin Elmer | NEL540001EA | |
| Branson Sonifier, Model SSE-1 | Branson | ||
| CircLigase I | VWR | 76081-606 | ssDNA ligase I |
| DMEM, High Glucose | ThermoFisher | 11995-065 | |
| DNA load buffer NEB | NEB | ||
| Dynabeads Protein A | LifeTech | 10002D | |
| Flp-In-T-REx 293 Cell Line | ThermoFisher | R78007 | |
| GeneRuler Low Range DNA Ladder | ThermoScientific | FERSM1203 | |
| Hygromycin B | ThermoFisher | 10687010 | |
| Mini-PROTEAN TBE Gel 10 well | Bio-Rad | 4565013 | |
| Mini-PROTEAN TBE-Urea Gel | Bio-Rad | 4566033 | |
| miRCAT-33 adapter 5′-TGGAATTCTCGGGTGCCAAGGddC-3′ | Any | this protocol is only compatible with the Illumina sequencing platform | |
| Mirus transIT-X2 transfection reagent | Mirus | MIR 6004 | |
| Mth RNA ligase | NEB | E2610S | |
| PE1.0 5′-AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATC*T-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| PE2.0 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTC GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100ml) | Fisher | BP1752I-100 | |
| Purple Gel Loading Dye (6x) | NEB | NEB #7025 | |
| Q5 DNA Polymerase | NEB | M0491S/L | |
| RNase I, E. coli, 1000 units | Eppicenter | N6901K | |
| SPIN-X column | Corning | CLS8160-24EA | |
| Streptavidin beads | ThermoFisher | 60210 | |
| Superscript III (SSIII) | ThermoScientific | 18080044 | reverse transcriptase enzyme |
| SybrGold | ThermoFisher | S11494 | gold nucleic acid gel stain |
| T4 Polynucleotide Kinase-2500U | NEB | M0201L | |
| T4RNL2 Tr. K227Q | NEB | M0351S | |
| Tetracycline | Sigma | 87128 | |
| Thermostable 5´ App DNA/RNA Ligase | NEB | M0319S | |
| TruSeq_SE1 5′-pGGCACTANNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE10 5′-pGGTGTTCNNNNNAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE11 5′-pGGTAAGTNNNNNAGATCGGAA GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE12 5′-pGGAGATGNNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE2 5′-pGGGTAGCNNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE35′-pGGTCGATNNNNNAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE4 5′-pGGCCTCGNNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE5 5′-pGGTGACANNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE6 5′-pGGTAGACNNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC CGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE7 5′-pGGGCCCTNNNNNAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT TCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE8 5′-pGGATCGGNNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT CCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE9 5′-pGGACTGANNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC CGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| Typhoon 5 Bimolecular Imager | GE Healthcare Life Science | 29187191 |
Referências
- Karousis, E. D., Nasif, S., Mühlemann, O. Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact. Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).
- Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways. The EMBO Journal. 27 (5), 736-747 (2008).
- Papasaikas, P., Valcárcel, J. The Spliceosome: The Ultimate RNA Chaperone and Sculptor. Trends in Biochemical Sciences. 41 (1), 33-45 (2016).
- Jensen, K. B., Darnell, R. B. CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins. Methods in Molecular Biology. 488, 85-98 (2008).
- Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins. mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).
- Konig, J., et al. iCLIP – Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution. Journal of Visualized Experiments. (50), e2638 (2011).
- Sibley, C. R. Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions. RNA Detection: Methods and Protocols. 1649, 427-454 (2018).
- Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. Advances and challenges in the detection of transcriptome‐wide protein-RNA interactions. Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).
- Singh, G., et al. The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus. Cell. 151, 750-764 (2012).
- Singh, G., Ricci, E. P., Moore, M. J. RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes. Methods. 65, 320-332 (2014).
- Mabin, J. W., et al. The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity. Cell Reports. 25 (9), 2431-2446 (2018).
- Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. Disassembly of Exon Junction Complexes by PYM. Cell. 137 (3), 536-548 (2009).
- Dostie, J., Dreyfuss, G. Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm. Current Biology. 12 (13), 1060-1067 (2002).
- Zünd, D., Gruber, A. R., Zavolan, M., Mühlemann, O. Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3′ UTRs. Nature Structural & Molecular Biology. 20 (8), 936-943 (2013).
- Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing. Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).
- Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments. Nucleic Acids Research. 43 (1), 2 (2015).
- Cameron, V., Uhlenbeck, O. C. 3′-Phosphatase activity in T4 polynucleotide kinase. Bioquímica. 16 (23), 5120-5126 (1977).
- Ricci, E. P., et al. Staufen1 senses overall transcript secondary structure to regulate translation. Nature Structural & Molecular Biology. 21 (1), 26-35 (2014).
- Lackner, D. H., et al. A generic strategy for CRISPR-Cas9-mediated gene tagging. Nature Communications. 6, 10237 (2015).
- Metkar, M., et al. Higher-Order Organization Principles of Pre-translational mRNPs. Molecular Cell. 72 (4), 715-726 (2018).
- Giudice, G., Sánchez-Cabo, F., Torroja, C., Lara-Pezzi, E. ATtRACT-a database of RNA-binding proteins and associated motifs. Database: The Journal of Biological Databases and Curation. 2016, (2016).
- Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. RBPmap: a web server for mapping binding sites of RNA-binding proteins. Nucleic Acids Research. 42, 361-367 (2014).
- Sundararaman, B., et al. Resources for the Comprehensive Discovery of Functional RNA Elements. Molecular Cell. 61 (6), 903-913 (2016).
