זיהוי של טביעות רגליים של RNA: מכלולי חלבון באמצעות RNA Immunoprecipitation בטנדם ואחריו רצף (RIPiT-Seq)
Summary
כאן, אנו מציגים פרוטוקול להעשיר את אתרי ה-RNA האנדוגניים או “עקבות” של RNA: מכלולי חלבון (RNP) מתאי יונקים. גישה זו כוללת שני immunoprecipitations של RNP תת יחידות, ולכן המכונה RNA immunoprecipitation בטנדם (RIPiT).
Abstract
רנ א immunoprecipitation בטנדם (RIPiT) היא שיטה להעשרת עקבות RNA של שני החלבונים בתוך RNA: חלבון (RNP) קומפלקס. RIPiT מעסיקה שני צעדי טיהור. ראשית, immunoprecipitation של RNP מתויג משנה לאחר מכן העיכול מתון RNase ובעקבות הימנעות האהדה הבאה. הimmunoprecipitation השנייה של יחידת משנה RNP נוספת מאפשרת להעשיר מתחם מוגדר. בעקבות הימנעות של RNAs וחלבונים, עקבות ה-RNA מומרים לספריות רצפי DNA של תפוקה גבוהה. בניגוד לאולטרה סגול פופולרי (UV) החוצה קישור ואחריו immunoprecipitation (CLIP) גישה להעשיר RBP אתרי כריכה, RIPiT הוא UV-crosslinking עצמאי. מכאן RIPiT יכול להיות מיושם על חלבונים רבים הנמצאים ב-RNA interactome ומעבר כי הם חיוניים רגולציה RNA אבל לא ישירות ליצור קשר עם RNA או UV-crosslink גרוע RNA. שני צעדי הטיהור בריבור מספקים יתרון נוסף של זיהוי אתרי קשירה שבהם חלבון הריבית מתפקד בשותפות עם קופקטור אחר. אסטרטגיית הטיהור הכפולה משמשת גם להגברת האות באמצעות הגבלת הרקע. כאן, אנו מספקים הליך מבחינת צעד כדי לבצע RIPiT ולייצר התפוקה גבוהה ברצף ספריות מתוך עקבות RNA מבודדים. כמו כן, אנו מתווה את היתרונות והיישומים של RIPiT ודנים בחלק מהמגבלות שלה.
Introduction
בתוך תאים, RNA קיים מורכב עם חלבונים כדי ליצור RNA: מכלולי חלבון (RNPs). RNPs מקובצים סביב ה-RNA כריכת חלבונים (Rnps, אלה אשר לאגד ישירות RNA) אבל גם מהווים ללא Rnps (אלה לאגד Rnps אך לא RNA), ולעתים קרובות דינמי בטבע. RBPs והקופדים שלהם פועלים באופן קולקטיבי בתוך Rbps כדי לבצע פעולות רגולטוריות. לדוגמה, ב-mRNA בתיווך שטויות (NMD) מסלול, החלבונים UPF (UPF1, UPF2, ו UPF3b) מזהים את ריבוכמה הסתיים בטרם עת. כל אחד מחלבונים UPF יכול לאגד RNA, אבל זה רק כאשר הם להרכיב יחד כי מורכבת NMD פעיל מתחיל להיווצר. בתוך מתחם זה, UPF1 מופעל עוד על ידי זירחון על ידי SMG1 שאינו rbp, והפעלת UPF1 כגון בסופו של דבר מובילה לגיוס של מקדם ריקבון mrna הגורם1,2. בדוגמה זו, RBPs דורש שחקנים שאינם מבוססי RBPS עבור גיוס והפעלה של מתחם RBPS המפעיל את NMD. מאפיין נוסף של RNPs הוא הטרוגניות שלהם. שקול את הספצאוחלק, אשר קיים ברורים E, A, B או C מתחמים. מתחמים שונים מתחמי יש לחפוף חלבונים ברורים3. כדי ללמוד פונקציות RNP, חשוב להבהיר אילו Rnp מאוגדים על ידי RNP ואת החלבונים המשויכים שלה. שיטות רבות קיימות כדי להשיג זאת, עם כל גישה יש יתרונות וחסרונות ברורים שלה4,5,6,7.
השיטות הנפוצות ביותר כדי לזהות אתרי כריכה RBP-הקישור ואחריו immunoprecipitation (קליפ) ואת הווריאציות השונות שלה-להסתמך על אולטרה סגול (UV) אור כדי crosslinking RBP ל-RNA8. עם זאת, זו אינה גישה אפקטיבית עבור non-RBPs בתוך Rbps, אשר אינם פונים אל RNA ישירות. כאן, אנו מתארים גישה חלופית הישימה ל-RBPs וללא RBPs כאחד, כדי לבודד ולזהות את אתרי איגוד ה-RNA שלהם. גישה זו נקראת RNA immunoprecipitation בטנדם (ripit) מורכב משני שלבים immunoprecipitation, אשר לעזור להשיג ספציפיות יותר לעומת טיהור אחד (איור 1)9,10. כפי שניתן לבצע את הצעדים הבודדים immunoprecipitation (IP) באופן מוגזם לעומת הקליפ, RIPiT אינו תלוי בזמינות של נוגדנים שיכולים לעמוד בפני נוכחות של חומרי ניקוי חזקים במהלך immunoprecipitation. היתרון הייחודי ביותר של RIPiT הוא היכולת למקד שני חלבונים שונים בשני שלבי טיהור; הדבר מספק דרך רבת-עוצמה להעשיר את מתחם ה-RNP שונה ומורכב מתסביכים דומים אחרים11.
וריאציות קטנות להליך RIPiT יכול לשפר עוד יותר את העשרה RNP. למשל, כמה אינטראקציות RNA-חלבון או חלבון-חלבון בתוך RNPs הם ארעי וזה עלול להיות קשה לטהר ביעילות את העקבות של תסביכים כאלה. כדי לייצב אינטראקציות כאלה, RNPs יכול להיות מקושר בתוך תאים עם פורמלדהיד לפני הליזה תא ו RIPiT. לדוגמה, ראינו כי אינטראקציה חלשה בין מורכבות הצומת אקסון (ejc) הליבה גורם, EIF4AIII וגורם פירוק ejc, pym12 ניתן לייצב עם טיפול פורמלדהיד כגון זה יותר העקבות RNA מועשרים (נתונים לא מוצג). לפני איסוף התא RIPiT, תאים יכולים גם להיות מטופלים עם תרופות כדי לייצב או להעשיר RNPs במצב מסוים. לדוגמה, כאשר לומדים חלבונים שהוסרו מ-mRNA במהלך התרגום (למשל, EJC13, UPF114), טיפול במעכבי תרגום כגון puromycin, cycloheximide או harringtonine יכול להוביל לאכלוס מוגבר של חלבונים ב-RNAs.
כמות ה-RNA ששוחזר מ-RIPiT נמוך בדרך כלל (0.5-10 שומות, כלומר, 10-250 ng RNA בהתחשב באורך RNA ממוצע של 75 nt). הסיבה העיקרית לכך היא כי רק חלק קטן של חלבון נתון קיים מורכב עם חלבונים אחרים בתוך RNPs (כל “חינם” החלבון IP’ed בשלב הראשון הוא איבד במהלך ה-IP השני). כדי לייצר ספריות rna-Seq מן ה-rna הזה, אנחנו גם מתווה כאן עיבוד של פרוטוקול שפורסם בעבר מתאים כגון RNA נמוך כגון15,16 (איור 2), אשר מניב את התפוקה הגבוהה ברצף מוכן דגימות של 3 ימים.
Protocol
Representative Results
Discussion
אנו דנים כאן כמה שיקולים מרכזיים כדי לבצע בהצלחה RIPiT. בראש ובראשונה, כתובות Ip בודדות חייבות להיות ממוטבות להשגת היעילות הגבוהה ביותר בכל שלב. כמות חרוזים הדגל העלה עבור מספר הקלט של תאים שתוארו כאן הוכיחה להיות חזקים עבור מגוון רחב של חלבונים שבדקנו. כמו רק חלק קטן של חלבונים שותפים הוא co-immu…
Declarações
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכת על ידי מענק NIH GM120209 (GS). המחברים מודים לליבה של משאבים משותפים גנומיקה של אוסוקCC עבור שירותיהם (מענק תמיכת CCC NCI P30 CA16058).
Materials
| Anti-FLAG Affinity Gel | Sigma | A2220 | |
| ATP, [γ-32P]- 3000Ci/mmol 10mCi/ml EasyTide, 250µCi | PerkinElmer | BLU502A250UC | |
| BD Disposable Syringes with Luer-Lok Tips (200) | Fisher | 14-823-435 | |
| Betaine 5M | Sigma | B0300 | |
| biotin-dATP | TriLink | N-5002 | |
| biotin-dCTP | Perkin Elmer | NEL540001EA | |
| Branson Sonifier, Model SSE-1 | Branson | ||
| CircLigase I | VWR | 76081-606 | ssDNA ligase I |
| DMEM, High Glucose | ThermoFisher | 11995-065 | |
| DNA load buffer NEB | NEB | ||
| Dynabeads Protein A | LifeTech | 10002D | |
| Flp-In-T-REx 293 Cell Line | ThermoFisher | R78007 | |
| GeneRuler Low Range DNA Ladder | ThermoScientific | FERSM1203 | |
| Hygromycin B | ThermoFisher | 10687010 | |
| Mini-PROTEAN TBE Gel 10 well | Bio-Rad | 4565013 | |
| Mini-PROTEAN TBE-Urea Gel | Bio-Rad | 4566033 | |
| miRCAT-33 adapter 5′-TGGAATTCTCGGGTGCCAAGGddC-3′ | Any | this protocol is only compatible with the Illumina sequencing platform | |
| Mirus transIT-X2 transfection reagent | Mirus | MIR 6004 | |
| Mth RNA ligase | NEB | E2610S | |
| PE1.0 5′-AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATC*T-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| PE2.0 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTC GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100ml) | Fisher | BP1752I-100 | |
| Purple Gel Loading Dye (6x) | NEB | NEB #7025 | |
| Q5 DNA Polymerase | NEB | M0491S/L | |
| RNase I, E. coli, 1000 units | Eppicenter | N6901K | |
| SPIN-X column | Corning | CLS8160-24EA | |
| Streptavidin beads | ThermoFisher | 60210 | |
| Superscript III (SSIII) | ThermoScientific | 18080044 | reverse transcriptase enzyme |
| SybrGold | ThermoFisher | S11494 | gold nucleic acid gel stain |
| T4 Polynucleotide Kinase-2500U | NEB | M0201L | |
| T4RNL2 Tr. K227Q | NEB | M0351S | |
| Tetracycline | Sigma | 87128 | |
| Thermostable 5´ App DNA/RNA Ligase | NEB | M0319S | |
| TruSeq_SE1 5′-pGGCACTANNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE10 5′-pGGTGTTCNNNNNAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE11 5′-pGGTAAGTNNNNNAGATCGGAA GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE12 5′-pGGAGATGNNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE2 5′-pGGGTAGCNNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE35′-pGGTCGATNNNNNAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE4 5′-pGGCCTCGNNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE5 5′-pGGTGACANNNNNAGATCGGAAGA GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC TTCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE6 5′-pGGTAGACNNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC CGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE7 5′-pGGGCCCTNNNNNAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT TCCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE8 5′-pGGATCGGNNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT CCGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| TruSeq_SE9 5′-pGGACTGANNNNNAGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC CGATCTCCTTGGCACCCGAGAATTCCA-3′ |
Any | this protocol is only compatible with the Illumina sequencing platform | |
| Typhoon 5 Bimolecular Imager | GE Healthcare Life Science | 29187191 |
Referências
- Karousis, E. D., Nasif, S., Mühlemann, O. Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact. Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).
- Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways. The EMBO Journal. 27 (5), 736-747 (2008).
- Papasaikas, P., Valcárcel, J. The Spliceosome: The Ultimate RNA Chaperone and Sculptor. Trends in Biochemical Sciences. 41 (1), 33-45 (2016).
- Jensen, K. B., Darnell, R. B. CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins. Methods in Molecular Biology. 488, 85-98 (2008).
- Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins. mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).
- Konig, J., et al. iCLIP – Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution. Journal of Visualized Experiments. (50), e2638 (2011).
- Sibley, C. R. Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions. RNA Detection: Methods and Protocols. 1649, 427-454 (2018).
- Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. Advances and challenges in the detection of transcriptome‐wide protein-RNA interactions. Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).
- Singh, G., et al. The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus. Cell. 151, 750-764 (2012).
- Singh, G., Ricci, E. P., Moore, M. J. RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes. Methods. 65, 320-332 (2014).
- Mabin, J. W., et al. The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity. Cell Reports. 25 (9), 2431-2446 (2018).
- Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. Disassembly of Exon Junction Complexes by PYM. Cell. 137 (3), 536-548 (2009).
- Dostie, J., Dreyfuss, G. Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm. Current Biology. 12 (13), 1060-1067 (2002).
- Zünd, D., Gruber, A. R., Zavolan, M., Mühlemann, O. Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3′ UTRs. Nature Structural & Molecular Biology. 20 (8), 936-943 (2013).
- Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing. Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).
- Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments. Nucleic Acids Research. 43 (1), 2 (2015).
- Cameron, V., Uhlenbeck, O. C. 3′-Phosphatase activity in T4 polynucleotide kinase. Bioquímica. 16 (23), 5120-5126 (1977).
- Ricci, E. P., et al. Staufen1 senses overall transcript secondary structure to regulate translation. Nature Structural & Molecular Biology. 21 (1), 26-35 (2014).
- Lackner, D. H., et al. A generic strategy for CRISPR-Cas9-mediated gene tagging. Nature Communications. 6, 10237 (2015).
- Metkar, M., et al. Higher-Order Organization Principles of Pre-translational mRNPs. Molecular Cell. 72 (4), 715-726 (2018).
- Giudice, G., Sánchez-Cabo, F., Torroja, C., Lara-Pezzi, E. ATtRACT-a database of RNA-binding proteins and associated motifs. Database: The Journal of Biological Databases and Curation. 2016, (2016).
- Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. RBPmap: a web server for mapping binding sites of RNA-binding proteins. Nucleic Acids Research. 42, 361-367 (2014).
- Sundararaman, B., et al. Resources for the Comprehensive Discovery of Functional RNA Elements. Molecular Cell. 61 (6), 903-913 (2016).
