نظام استزراع ثلاثي الأبعاد خال من المصل للخلايا الجذعية للغدة الدمعية
Summary
إن طريقة الاستزراع ثلاثية الأبعاد الخالية من المصل للخلايا الجذعية للغدة الدمعية البالغة (LG) راسخة لتحريض تكوين LG العضوي والتمايز إلى خلايا تشبه الخلايا الشبيهة بالقنوات.
Abstract
يعد العلاج القائم على الخلايا الجذعية في الغدة الدمعية (LG) استراتيجية واعدة لأمراض الغدة الدمعية. ومع ذلك ، فإن عدم وجود طريقة استزراع موثوقة وخالية من المصل للحصول على عدد كاف من الخلايا الجذعية LG (LGSCs) هو أحد العقبات أمام مزيد من البحث والتطبيق. طريقة الثقافة ثلاثية الأبعاد (3D) الخالية من المصل ل LGSCs للفئران البالغة راسخة ومعروضة هنا. يمكن تمرير LGSCs باستمرار وحثها على التمايز إلى خلايا تشبه الخلايا الشبيهة بالقنوات.
بالنسبة للثقافة الأولية LGSC ، تم هضم LGs من الفئران التي يتراوح عمرها بين 6 و 8 أسابيع باستخدام dispase و collagenase I و trypsin-EDTA. تم زرع ما مجموعه 1 × 104 خلايا مفردة في 80 ميكرولتر من مصفوفة الخلايا الجذعية المتوسطة للغدة الهلامية الدمعية (LGSCM) في كل بئر من صفيحة من 24 بئرا ، مغلفة مسبقا ب 20 ميكرولتر من مصفوفة هلام LGSCM المصفوفة. تم تصلب المزيج بعد الحضانة لمدة 20 دقيقة عند 37 درجة مئوية ، وإضافة 600 ميكرولتر من LGSCM.
لصيانة LGSC ، تم تصنيف LGSCs المستزرعة لمدة 7 أيام إلى خلايا مفردة عن طريق dispase و trypsin-EDTA. تم زرع الخلايا المفردة وزراعتها وفقا للطريقة المستخدمة في الثقافة الأولية LGSC. يمكن تمرير LGSCs أكثر من 40 مرة والتعبير باستمرار عن علامات الخلايا الجذعية / السلفية Krt14 و Krt5 و P63 و nestin. تتمتع LGSCs المستزرعة في LGSCM بقدرة على التجديد الذاتي ويمكن أن تتمايز إلى خلايا تشبه الخلايا الشبيهة بالقنوات في المختبر وفي الجسم الحي.
Introduction
تحافظ الخلايا الجذعية للغدة الدمعية (LGSCs) على تجديد خلايا الغدة الدمعية (LG) وهي مصدر الخلايا القنوية والقنوية. لذلك ، تعتبر زراعة LGSC نهجا بديلا لعلاج الأضرار الالتهابية الشديدة ومرض جفاف العين الناجم عن نقص مائي (ADDED) 1،2،3. تم تطبيق العديد من طرق الاستزراع لإثراء LGSCs. Tiwari et al. فصل وزراعة خلايا LG الأولية باستخدام الكولاجين I وهلام المصفوفة المكملة بالعديد من عوامل النمو. ومع ذلك ، لا يمكن زراعة خلايا LG باستمرار4. باستخدام ثقافة ثنائية الأبعاد (2D) ، تم عزل الخلايا الجذعية المشتقة من LG بواسطة You et al.5 و Ackermann et al. 6 ، وجدت للتعبير عن جينات علامة الخلية الجذعية / السلف ، Oct4 ، Sox2 ، Nanog ، و nestin ، ويمكن زراعتها الفرعية. ومع ذلك ، لا يوجد مؤشر واضح على أن هذه الخلايا يمكن أن تتمايز إلى خلايا أسينار أو أقنية ، ولا توجد تجربة زرع للتحقق من إمكانات التمايز في الجسم الحي.
في الآونة الأخيرة ، تم عزل خلايا c-kit + dim / EpCAM + / Sca1-/CD34-/CD45– من LGs الفأر عن طريق قياس التدفق الخلوي ، ووجد أنها تعبر عن علامات الخلايا السلفية LG ، مثل Pax6 و Runx1 ، وتم تمييزها إلى قنوات و acini في المختبر. في الفئران التي تحتوي على ADD ، يمكن للحقن التقويمي بهذه الخلايا إصلاح LGs التالفة واستعادة الوظيفة الإفرازية ل LGs2. ومع ذلك ، كان عدد الخلايا الجذعية المعزولة بهذه الطريقة صغيرا ، ولا توجد ظروف استزراع مناسبة لتوسيع LGSCs المعزولة. وباختصار، يلزم إنشاء نظام استزراع مناسب لعزل وزراعة LGSCs البالغة بشكل فعال مع التوسع المستقر والمستمر لدراسة LGSCs في علاج ADDED.
المواد العضوية المشتقة من الخلايا الجذعية أو الخلايا الجذعية متعددة القدرات هي مجموعة من الخلايا التي تشبه نسيجيا الأعضاء ذات الصلة ويمكنها الحفاظ على تجديدها الخاص. بعد أن تم استزراع أمعاء الفئران بنجاح من قبل ساتو وآخرون في عام 20097 ، تم استزراع المواد العضوية من الأعضاء الأخرى على التوالي ، استنادا إلى نظام زراعة ساتو ، مثل المرارة8 والكبد9 والبنكرياس10 والمعدة 11 والثدي12 والرئة 13 والبروستاتا 14 والغدة اللعابية 15 . نظرا لارتفاع نسبة الخلايا الجذعية البالغة قبل تمايز الخلايا في الثقافة العضوية ، تعتبر طريقة الزراعة العضوية ثلاثية الأبعاد (3D) مثالية لعزل وزراعة الخلايا الجذعية البالغة من LG.
تم إنشاء نظام ثقافة LGSC للفئران البالغة في هذه الدراسة من خلال تحسين طريقة الثقافة 3D الخالية من المصل. ثبت أن LGSCs المستزرعة من كل من الفئران العادية و ADDED أظهرت قدرة مستقرة على التجديد الذاتي والانتشار. بعد الزرع في LGs الماوس المضافة ، استعمرت LGSCs LGs الضعيفة وحسنت إنتاج المسيل للدموع. بالإضافة إلى ذلك ، تم عزل LGSCs الفلورسنت الأحمر من الفئران ROSA26mT / mG وزرعها. يوفر هذا العمل مرجعا موثوقا به لإثراء LGSC في المختبر والطعم الذاتي LGSC في التطبيق السريري للعلاج المضاف.
Protocol
Representative Results
Discussion
هناك طرق راسخة لعزل الخلايا الجذعية الدمعية وزراعتها في المختبر لزراعة الخلايا الجذعية الدمعية وإصلاح إصابات LG. شاتوس وآخرون.17 وأكرمانوآخرون. 6 الخلايا الجذعية الدمعية المستزرعة بنجاح وشبه المستزرعة من الجرذان والفئران بطرق زراعة 2D ، على التوالي ، مما…
Declarações
The authors have nothing to disclose.
Acknowledgements
تم دعم هذا العمل من خلال منحة من المؤسسة الوطنية للعلوم الطبيعية في الصين (رقم 31871413) وبرنامجين من قوانغدونغ للعلوم والتكنولوجيا (2017B020230002 و 2016B030231001). نحن ممتنون حقا للباحثين الذين ساعدونا خلال الدراسة وللموظفين العاملين في مركز الحيوانات لدعمهم في رعاية الحيوانات.
Materials
| Animal(Mouse) | |||
| Bal B/C | Model Animal Research Center of Nanjing University | ||
| C57 BL/6J | Laboratory Animal Center of Sun Yat-sen University | ||
| NOD/ShiLtJ | Model Animal Research Center of Nanjing University | ||
| ROSA26mT/mG | Model Animal Research Center of Nanjing University | ||
| Equipment | |||
| Analytical balance | Sartorius | ||
| Automatic dehydrator | Thermo | ||
| Blood counting chamber | BLAU | ||
| Cell Counter | CountStar | ||
| CO2 constant temperature incubator | Thermo | ||
| ECL Gel imaging system | GE healthcare | ||
| Electric bath for water bath | Yiheng Technology | ||
| Electrophoresis apparatus | BioRad | ||
| Fluorescence quantitative PCR instrument | Roche | ||
| Frozen tissue slicer | Lecia | ||
| Horizontal centrifuge | CENCE | ||
| Inverted fluorescence microscope | Nikon | ||
| Inverted microscope | Olympus | ||
| Laser lamellar scanning micrograph | Carl Zeiss | ||
| Liquid nitrogen container | Thermo | ||
| Low temperature high speed centrifuge | Eppendorf | ||
| Micropipettor | Gilson | ||
| Microwave oven | Panasonic | ||
| Nanodrop ultraviolet spectrophotometer | Thermo | measure RNA concentration | |
| Paraffin slicing machine | Thermo | ||
| PCR Amplifier | Eppendorf | ||
| pH value tester | Sartorius | ||
| 4 °C Refrigerator | Haier | ||
| Thermostatic culture oscillator | ZHICHENG | ||
| Tissue paraffin embedding instrument | Thermo | ||
| -80°C Ultra-low temperature refrigerator | Thermo | ||
| -20°C Ultra-low temperature refrigerator | Thermo | ||
| Ultra pure water purification system | ELGA | ||
| Reagent | |||
| Animal Experiment | |||
| HCG | Sigma | 9002-61-3 | |
| PMSG | Sigma | 14158-65-7 | |
| Pentobarbital Sodium | Sigma | 57-33-0 | |
| Cell Culture | |||
| B27 | Gibco | 17504044 | |
| Collagenase I | Gibco | 17018029 | |
| Dispase | BD | 354235 | |
| DMEM | Sigma | D6429 | |
| DMEM/F12 | Sigma | D0697 | |
| DMSO | Sigma | 67-68-5 | |
| EDTA | Sangon Biotech | A500895 | |
| Foetal Bovine Serum | Gibco | 04-001-1ACS | |
| GlutaMax | Gibco | 35050087 | |
| Human FGF10 | PeproTech | 100-26 | |
| Matrigel (Matrix gel) | BD | 356231 | |
| Murine Noggin | PeproTech | 250-38 | |
| Murine Wnt3A | PeproTech | 315-20 | |
| Murine EGF | PeproTech | 315-09 | |
| NEAA | Gibco | 11140050 | |
| N2 | Gibco | 17502048 | |
| R-spondin 1 | PeproTech | 120-38 | |
| Trypsin Inhibitor (TI) | Sigma | T6522 | Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin. |
| Trypsin | Sigma | T4799 | |
| Y-27632 | Selleck | S1049 | |
| HE staining & Immunostaining | |||
| Alexa Fluor 488 donkey anti-Mouse IgG | Thermo | A-21202 | Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL |
| Alexa Fluor 488 donkey anti-Rabbit IgG | Thermo | A-21206 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Mouse IgG | Thermo | A-10037 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Rabbit IgG | Thermo | A-10042 | Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL |
| Anti-AQP5 rabbit antibody | Abcam | ab104751 | Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL |
| Anti-E-cadherin Rat antibody | Abcam | ab11512 | Used dilution: (IF) 5 μg/mL |
| Anti-Keratin14 rabbit antibody | Abcam | ab181595 | Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL |
| Anti-Ki67 rabbit antibody | Abcam | ab15580 | Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL |
| Anti-mCherry mouse antibody | Abcam | ab125096 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Anti-mCherry rabbit antibody | Abcam | ab167453 | Used dilution: (IF) 2 μg/mL |
| C6H8O7 | Sangon Biotech | A501702-0500 | |
| Citric Acid | Sangon Biotech | 201-069-1 | |
| DAB Kit (20x) | CWBIO | CW0125 | |
| DAPI | Thermo | 62248 | |
| Eosin | BASO | 68115 | |
| Fluorescent Mounting Medium | Dako | S3023 | |
| Formalin | Sangon Biotech | A501912-0500 | |
| Goat anti-Mouse IgG antibody (HRP) | Abcam | ab6789 | Used dilution: 2 μg/mL |
| Goat anti-Rabbit IgG antibody(HRP) | Abcam | ab6721 | Used dilution: 2 μg/mL |
| Hematoxylin | BASO | 517-28-2 | |
| Histogel (Embedding hydrogel) | Thermo | HG-400-012 | |
| 30% H2O2 | Guangzhou Chemistry | KD10 | |
| 30% Hydrogen Peroxide Solution | Guangzhou Chemistry | 7722-84-1 | |
| Methanol | Guangzhou Chemistry | 67-56-1 | |
| Na3C6H5O7.2H2O | Sangon Biotech | A501293-0500 | |
| Neutral balsam | SHANGHAI YIYANG | YY-Neutral balsam | |
| Non-immunized Goat Serum | BOSTER | AR0009 | |
| Paraffin | Sangon Biotech | A601891-0500 | |
| Paraformaldehyde | DAMAO | 200-001-8 | |
| Saccharose | Guangzhou Chemistry | 57-50-1 | |
| Sodium citrate tribasic dihydrate | Sangon Biotech | 200-675-3 | |
| Sucrose | Guangzhou Chemistry | IB11-AR-500G | |
| Tissue-Tek O.T.C. Compound | SAKURA | SAKURA.4583 | |
| Triton X-100 | DINGGUO | 9002-93-1 | |
| Xylene | Guangzhou Chemistry | 128686-03-3 | |
| RT-PCR & qRT-PCR | |||
| Agarose | Sigma | 9012-36-6 | |
| Alcohol | Guangzhou Chemistry | 64-17-5 | |
| Chloroform | Guangzhou Chemistry | 865-49-6 | |
| Ethidium Bromide | Sangon Biotech | 214-984-6 | |
| Isopropyl Alcohol | Guangzhou Chemistry | 67-63-0 | |
| LightCycler 480 SYBR Green I Master Mix | Roche | 488735200H | |
| ReverTra Ace qPCR RT Master Mix | TOYOBO | – | |
| Taq DNA Polymerase | TAKARA | R10T1 | |
| Goldview (nucleic acid stain) | BioSharp | BS357A | |
| TRIzol | Magen | R4801-02 | |
| Vector Construction & Cell Transfection | |||
| Agar | OXID | – | |
| Ampicillin | Sigma | 69-52-3 | |
| Chloramphenicol | Sigma | 56-75-7 | |
| Endotoxin-free Plasmid Extraction Kit | Thermo | A36227 | |
| Kanamycin | Sigma | 25389-94-0 | |
| Lipo3000 Plasmid Transfection Kit | Thermo | L3000015 | |
| LR Reaction Kit | Thermo | 11791019 | |
| Plasmid Extraction Kit | TIANGEN | DP103 | |
| Trans5α Chemically Competent Cell | TRANSGEN | CD201-01 | |
| Trytone | OXID | – | |
| Yeast Extract | OXID | – | |
| Primers and Sequence | Company | ||
| Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC |
Synbio Tech | ||
| Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT |
Synbio Tech | ||
| Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG |
Synbio Tech | ||
| Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC |
Synbio Tech | ||
| Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC |
Synbio Tech | ||
| Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT |
Synbio Tech | ||
| Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA |
Synbio Tech | ||
| Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT |
Synbio Tech | ||
| Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC |
Synbio Tech | ||
| Vector | |||
| pLX302 lentivirus no-load vector | Addgene | ||
| pENRTY-mCherry | Xiaofeng Qin laboratory, Sun Yat-sen University |
Referências
- Zoukhri, D., Macari, E., Kublin, C. L. A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation. Experimental Eye Research. 84 (5), 894-904 (2007).
- Gromova, A., et al. Lacrimal gland repair using progenitor cells. Stem Cells Translational Medicine. 6 (1), 88-98 (2016).
- Buzhor, E., et al. Cell-based therapy approaches: the hope for incurable diseases. Regenerative Medicine. 9 (5), 649-672 (2014).
- Tiwari, S., et al. Establishing human lacrimal gland cultures with secretory function. PLoS One. 7 (1), 29458 (2012).
- You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. Isolation and propagation of mesenchymal stem cells from the lacrimal gland. Investigative Ophthalmology & Visual Science. 52 (5), 2087-2094 (2011).
- Ackermann, P., et al. Isolation and investigation of presumptive murine lacrimal gland stem cells. Investigative Ophthalmology & Visual Science. 56 (8), 4350-4363 (2015).
- Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459 (7244), 262-265 (2009).
- Lugli, N., et al. R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders. EMBO Reports. 17 (5), 769-779 (2016).
- Huch, M., et al. Long-term culture of genome-stable bipotent stem cells from adult human liver. Cell. 160 (1), 299-312 (2015).
- Boj, S. F., et al. Organoid models of human and mouse ductal pancreatic cancer. Cell. 160 (1), 324-338 (2015).
- Barker, N., et al. Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell. 6 (1), 25-36 (2010).
- Linnemann, J. R., et al. Quantification of regenerative potential in primary human mammary epithelial cells. Development. 142 (18), 3239-3251 (2015).
- Rock, J. R., et al. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).
- Chua, C. W., et al. Single luminal epithelial progenitors can generate prostate organoids in culture. Nature Cell Biology. 16 (1), 951-961 (2014).
- Maimets, M., et al. Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals. Stem Cell Reports. 6 (1), 150-162 (2016).
- Xiao, S., Zhang, Y. Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair. Stem Cell Research & Therapy. 11 (1), 20 (2020).
- Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland. Investigative Ophthalmology & Visual Science. 53 (6), 2749-2759 (2012).
- Mishima, K., et al. Transplantation of side population cells restores the function of damaged exocrine glands through clusterin. Stem Cells. 30 (9), 1925-1937 (2012).
- Aluri, H. S., et al. Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sjögren’s syndrome. Stem Cells International. 2017, 1-10 (2017).
- Dietrich, J., Schrader, S. Towards lacrimal gland regeneration: current concepts and experimental approaches. Current Eye Research. 45 (3), 230-240 (2020).
- Sato, T., Clevers, H. SnapShot: growing organoids from stem cells. Cell. 161 (7), 1700 (2015).
- Kleinman, H. K., Martin, G. R. Matrigel: basement membrane matrix with biological activity. Seminars in Cancer Biology. 15 (5), 378-386 (2005).
- Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. Basement membrane matrix (BME) has multiple uses with stem cells. Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).
