भ्रूण चिकन लेंस में पुनः संयोजक आरसीएएस (ए) रेट्रोवायरस का माइक्रोइंजेक्शन
Summary
यह प्रोटोकॉल पेपर लेंस विकास के दौरान प्रोटीन के सीटू फ़ंक्शन और अभिव्यक्ति में अध्ययन के लिए एक उपकरण के रूप में आरसीएएस (ए) रेट्रोवायरस के भ्रूण चिकन लेंस माइक्रोइंजेक्शन की कार्यप्रणाली का वर्णन करता है।
Abstract
भ्रूण चिकन (गैलस डोमेस्टिकस) लेंस विकास और शरीर विज्ञान के अध्ययन के लिए एक अच्छी तरह से स्थापित पशु मॉडल है, जो मानव लेंस के साथ समानता की उच्च डिग्री को देखते हुए है। आरसीएएस (ए) एक प्रतिकृति-सक्षम चिकन रेट्रोवायरस है जो विभाजित कोशिकाओं को संक्रमित करता है, जो प्रारंभिक विकास चरणों में लेंस पुटिका के खाली लुमेन में माइक्रोइंजेक्शन द्वारा लेंस विकास के दौरान जंगली-प्रकार और उत्परिवर्ती प्रोटीन की सीटू अभिव्यक्ति और कार्य का अध्ययन करने के लिए एक शक्तिशाली उपकरण के रूप में कार्य करता है, जो इसकी कार्रवाई को आसपास के प्रसार लेंस कोशिकाओं तक सीमित करता है। अन्य दृष्टिकोणों की तुलना में, जैसे कि ट्रांसजेनिक मॉडल और एक्स विवो संस्कृतियां, आरसीएएस (ए) प्रतिकृति-सक्षम एवियन रेट्रोवायरस का उपयोग चिक भ्रूण में बहिर्जात प्रोटीन को व्यक्त करने के लिए एक अत्यधिक प्रभावी, तेज और अनुकूलन योग्य प्रणाली प्रदान करता है। विशेष रूप से, लक्षित जीन स्थानांतरण ऊतक-विशिष्ट प्रमोटरों की आवश्यकता के बिना प्रोलिफेरेटिव लेंस फाइबर कोशिकाओं तक सीमित हो सकता है। इस लेख में, हम पुनः संयोजक रेट्रोवायरस आरसीएएस (ए) तैयारी के लिए आवश्यक चरणों का संक्षेप में अवलोकन करेंगे, माइक्रोइंजेक्शन प्रक्रिया का एक विस्तृत, व्यापक अवलोकन प्रदान करेंगे, और तकनीक के नमूना परिणाम प्रदान करेंगे।
Introduction
इस प्रोटोकॉल का लक्ष्य आरसीएएस (ए) (प्रतिकृति-सक्षम एवियन सारकोमा / ल्यूकोसिस रेट्रोवायरस ए) के भ्रूण चिकन लेंस माइक्रोइंजेक्शन की पद्धति का वर्णन करना है। एक भ्रूण चिकन लेंस में प्रभावी रेट्रोवायरल डिलीवरी को सामान्य लेंस फिजियोलॉजी, पैथोलॉजिकल स्थितियों और विकास में लेंस प्रोटीन के आणविक तंत्र और संरचना-कार्य के विवो अध्ययन के लिए एक आशाजनक उपकरण के रूप में प्रदर्शित किया गया है। इसके अलावा, इस प्रयोगात्मक मॉडल का उपयोग चिकित्सीय लक्ष्यों की पहचान और मानव जन्मजात मोतियाबिंद जैसी स्थितियों के लिए दवा स्क्रीनिंग के लिए किया जा सकता है। कुल मिलाकर, इस प्रोटोकॉल का उद्देश्य लेंस प्रोटीन के अध्ययन के लिए एक अनुकूलन योग्य मंच के विकास के लिए आवश्यक कदम उठाना है।
भ्रूण के चूजों (गैलस डोमेस्टिकस), लेंस संरचना और मानव लेंस के साथ कार्य में उनकी समानता के कारण, लेंस विकास और शरीर विज्ञान 1,2,3,4 के अध्ययन के लिए एक अच्छी तरह से स्थापित पशु मॉडल हैं। आरसीएएस (ए) प्रतिकृति-सक्षम एवियन रेट्रोवायरस का उपयोग चिक भ्रूण में बहिर्जात प्रोटीन को व्यक्त करने के लिए एक अत्यधिक प्रभावी, तेज और अनुकूलन योग्य प्रणाली के रूप में माना जाता है। विशेष रूप से, इसमें ऊतक-विशिष्ट प्रमोटरों की आवश्यकता के बिना लक्ष्य जीन हस्तांतरण को प्रोलिफेरेटिव लेंस फाइबर कोशिकाओं तक सीमित करने की एक अनूठी क्षमता है, अद्वितीय भ्रूण विकास समय सीमा का उपयोग करते हुए जिसमें खाली लेंस लुमेन की उपस्थिति सीटू आरसीएएस (ए) माइक्रोइंजेक्शन को प्रोलिफेरेटिव लेंसफाइबर कोशिकाओं के भीतर बहिर्जात प्रोटीन की अभिव्यक्ति के लिए प्रतिबंधित साइट में अनुमति देती है। 6,7,8.
चूजा भ्रूण माइक्रोइंजेक्शन प्रक्रिया, यहां गहराई से वर्णित है, मूल रूप से आंशिक रूप से फेकेट एट के काम पर आधारित है। अल.6 और जियांग एट द्वारा आगे विकसित किया गया। और भ्रूण के चूजों 1,9,10,11,12,13 के लेंस में वायरल और नॉनवायरल प्लास्मिड दोनों को पेश करने के साधन के रूप में उपयोग किया गया है। कुल मिलाकर, पिछला काम लेंस विकास, भेदभाव, सेलुलर संचार और रोग की प्रगति का अध्ययन करने और मोतियाबिंद जैसे लेंस रोग स्थितियों के लिए चिकित्सीय लक्ष्यों की खोज और परीक्षण के लिए इस पद्धति का उपयोग करने की क्षमता को दर्शाता है।
Protocol
Representative Results
Discussion
यह प्रयोगात्मक मॉडल बरकरार लेंस में रुचि के प्रोटीन (ओं) को व्यक्त करने का अवसर प्रदान करता है जिससे लेंस संरचना और कार्य में इन प्रोटीनों की कार्यात्मक प्रासंगिकता का अध्ययन होता है। भ्रूण चिक माइक्र…
Declarações
The authors have nothing to disclose.
Acknowledgements
इस काम को राष्ट्रीय स्वास्थ्य संस्थान (एनआईएच) अनुदान द्वारा समर्थित किया गया था: आरओ 1 EY012085 (जेएक्सजे को) और F32DK134051 (एफएमए को), और वेल्च फाउंडेशन अनुदान: एक्यू -1507 (जेएक्सजे को)। सामग्री पूरी तरह से लेखकों की जिम्मेदारी है और जरूरी नहीं कि राष्ट्रीय स्वास्थ्य संस्थान के आधिकारिक विचारों का प्रतिनिधित्व करती हो। आंकड़े आंशिक रूप से Biorender.com के साथ बनाए गए थे।
Materials
| 0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
| 35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
| Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
| Constructs | GENEWIZ | – | For generation of constructs |
| Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
| DNA PCR primers | Integrated DNA Technologies | – | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
| Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
| Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
| Egg Holder | – | – | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
| Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
| Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
| Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
| Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
| Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
| Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
| Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
| Lipofectamine | Invitrogen | L3000001 | For transfection |
| Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
| Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
| Microscope | Keyence | BZ-X710 | For imaging staining |
| Parafilm | FisherScientific | 03-448-254 | Placing solution |
| Penicillin/Streptomycin | Invitrogen | For cell culture | |
| Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
| rabbit anti-chick AQP0 | Self generated | – | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
| rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
| Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
| Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
Referências
- Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. Development of a potent embryonic chick lens model for studying congenital cataracts in vivo. Communications Biology. 4 (1), 325 (2021).
- Chen, Y., et al. γ-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds. The FEBS Journal. 283 (8), 1516-1530 (2016).
- Coulombre, A. J., Coulombre, J. L. Lens development. I. Role of the lens in eye growth. Journal of Experimental Zoology. 156 (1), 39-47 (1964).
- McKeehan, M. S. Induction of portions of the chick lens without contact with the optic cup. The Anatomical Record. 132 (3), 297-305 (1958).
- Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo. Molecular immunology. 47 (7-8), 1619-1628 (2010).
- Fekete, D. M., Cepko, C. L. Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo. Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).
- Jiang, J. X. Use of retroviruses to express connexins. Methods in Molecular Biology. , 159-174 (2001).
- Jiang, J. X., Goodenough, D. A. Retroviral expression of connexins in embryonic chick lens. Investigative Ophthalmology & Visual Science. 39 (3), 537-543 (1998).
- Shestopalov, V. I., Bassnett, S. Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core. Journal of Cell Science. 113 (11), 1913-1921 (2000).
- Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50. Journal of Cell Science. 124 (2), 198-206 (2011).
- Li, Z., et al. The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression. Journal of Biological Chemistry. 299 (3), 102965 (2023).
- Shestopalov, V. I., Bassnett, S. Exogenous gene expression and protein targeting in lens fiber cells. Investigative Ophthalmology & Visual Science. 40 (7), 1435-1443 (1999).
- Shestopalov, V. I., Bassnett, S. Three-dimensional organization of primary lens fiber cells. Investigative Ophthalmology & Visual Science. 41 (3), 859-863 (2000).
- Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. Journal of Virology. 61 (10), 3004-3012 (1987).
- Yan, R. T., Wang, S. Z. Production of high-titer RCAS retrovirus. Methods in Molecular Biology. 884, 193-199 (2012).
- Kingston, R. E. Introduction of DNA into mammalian cells. Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).
- Li, Y., et al. Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model. STAR Protocols. 3 (1), 101060 (2022).
- Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Developmental Dynamics. 195 (4), 231-272 (1992).
- Hallagan, J. B., Allen, D. C., Borzelleca, J. F. The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification. Food and Chemical Toxicology. 33 (6), 515-528 (1995).
- Okada, T. S., Eguchi, G., Takeichi, M. The expression of differentiation by chicken lens epithelium in in vitro cell culture. Development, Growth & Differentiation. 13 (4), 323-336 (1971).
- Menko, A. S., Klukas, K. A., Johnson, R. G. Chicken embryo lens cultures mimic differentiation in the lens. Biologia do Desenvolvimento. 103 (1), 129-141 (1984).
- Parreno, J., et al. Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells. Frontiers in Cell and Developmental Biology. 10, 983178 (2022).
- Edwards, A., Gupta, J. D., Harley, J. D. Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens. Experimental Eye Research. 15 (4), 495-498 (1973).
- Musil, L. S. Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation. Journal of Membrane Biology. 245 (7), 357-368 (2012).
- West-Mays, J. A., Pino, G., Lovicu, F. J. Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis. Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).
- Upreti, A., et al. Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response. Cells. 12 (3), 501 (2023).
- Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. Activation of SRC kinases signals induction of posterior capsule opacification. Investigative Ophthalmology & Visual Science. 48 (5), 2214-2223 (2007).
- Briskin, M. J., et al. Heritable retroviral transgenes are highly expressed in chickens. Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).
- Hughes, S. H. The RCAS vector system. Folia Biologica. 50 (3-4), 107-119 (2004).
