The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.
The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.
Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents8,9by investigating the methodology of gene regulation and genome editing10.
Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes11. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family14,15,16. The RNAi method has been documented in at least 13 parasitoid species14,15,16,17,18,19. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate20,21,22.
In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe2+ to Fe3+. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.
Trichogramma wasps are recognized as effective biological control agents, specifically targeting a range of lepidopteran pests in agriculture and forestry1. These diminutive wasps undergo their immature stages within the host egg, a characteristic that presents challenges in conducting RNAi experiments5,18. This study offers a comprehensive visual guide for conducting RNAi experiments in T. denrolimi. Given the shared bio…
The authors have nothing to disclose.
This research was funded by the Projects of the National Natural Science Foundation of China (32172476, 32102275), the Agricultural Science and Technology Innovation Program (CAAS-ZDRW202203, CAAS-ZDRW202108), and Central Funds Guiding the Local Science and Technology Development (XZ202301YD0042C).
2x ES Taq MasterMix (Dye) | Cowin Biotech, China | CW0690H | To amplify the dsRNA sequences |
20x PBS Buffer, DEPC treated (7.2-7.6) | Sangon Biotech, China | B540627-0500 | To dilute dsRNA |
Agar strip | Shishi Globe Agar Industries Co.,Ltd, China | n/a | To make culture medium |
Ampicillin sodium | Sangon Biotech, China | A610028 | To make culture medium |
Bioer Constant temperature metal bath | BIOER, China | MB-102 | To synthesis dsRNA |
Borosilicate glass capillary | WPI, USA | 1B100-4 | To pull capillary glass needle |
Clean bench | Airtech, China | SW-CJ-1FD | To extract RNA |
Double distilled water | Sangon Biotech, China | A500197-0500 | To dilute cDNA |
Environmental Testing chamber | Panasonic, Japan | MLR-352H-PC | To culture T. denrolimi |
Eppendorf Centrifuge | Eppendrof, Germany | 5418R | To store RNA content |
Eppendorf FemtoJet 4i | Eppendrof, Germany | FemtoJet 4i | To inject T. denrolimi |
Eppendorf Refrigerated Centrifuge | Eppendrof, Germany | 5810R | Centrifuge |
Ethanol solution (75%, RNase-free) | Aladdin, China | M052131-500ml | To extract RNA |
Gel Extraction Kit | Omega, USA | D25000-02 | To extract cDNA |
GUM Arabic | Solarbio, China | CG5991-500g | To make egg card |
Isopropyl alchohol | Aladdin, China | 80109218 | To extract RNA |
Laser-Based Micropipette Puller | SUTTER, USA | P-2000 | To pull capillary glass needle |
Microloader | Eppendrof, Germany | 20 µL | To load dsRNA |
Multi-sample tissue grinder | LICHEN, China | LC-TG-24 | To grind T. denrolimi |
Needle Grinder | SUTTER, USA | BV-10-E | To grind capillary glass needle |
Nuclease-Free Water | Sangon Biotech, China | To dilute RNA | |
OLYMPUS Microscope | OLYMPUS, Japan | XZX16 | To observe T. denrolimi |
PCR machine | Bio-rad, USA | S-1000 | For DNA amplification |
PowerPac Basic | Bio-rad, USA | PowerPacTM Basic | To detect the quality of dsRNA |
Primer of dsGFP (Forward) | [TAATACGACTCACTATAGGG] ACAAACCAAGGCAAGTAATA |
||
Primer of dsGFP (Reverse) | [TAATACGACTCACTATAGGG] CAGAGGCATCTTCAACG |
||
Primer of Ferhch for qPCR (Forward) | TGAAGAGATTCTGCGTTCTGCT | ||
Primer of Ferhch for qPCR (Reverse) | CTGTAGGAACATCAGCAGGCTT | ||
Primer of Ferhch for RNAi (Reverse) | [TAATACGACTCACTATAGGG]AG TAGCCATCATCTTTCC |
||
Primer of Ferhch for RNAi(Forward) | [TAATACGACTCACTATAGGG] ACACTGTCAATCGTCCTG |
||
Primer of FoxO for qPCR (Forward) | CTACGCCGATCTCATAACGC | ||
Primer of FoxO for qPCR (Reverse) | TGCTGTCGCCCTTGTCCT | ||
PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) | TaKaRa, Japan | RR047A | |
Quantitative Real-time PCR | Bio-rad, USA | CFX 96 Touch | To perform reverse transcriptase polymerase chain reaction (RT-PCR) |
Real-time PCR (TaqMan) Primer and Probes Design Tool | https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/ | ||
T7 RiBoMAX Express RNAi System | Promega, USA | P1700 | To synthesis dsRNA in vitro |
TB Green Premix Ex TaqTM ![]() |
TaKaRa, Japan | RR820A | To perform RT-qPCR |
Trichloromethane | KESHI, China | GB/T682-2002 | To extract RNA |
TRIzol Reagent | Ambion, USA | 15596018 | To extract total RNA content from samples |
Ultra-low Temperature Freezer | Thermo, USA | Forma 911 |