Method Article

Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

DOI:

10.3791/60772

⸱

July 23rd, 2020

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

A diverse gut microbiota plays a major role in maintaining host homeostasis. This microbiome aids in various physiological processes ranging from digestion and absorption of nutrients from food, defense against infection of pathogens, regulation of immune system development, and immune homeostasis1. Perturbation in gut microbial composition has been linked to many diseases, including cancer2, autoimmune diseases3, inflammatory bowel disease4, neurological diseases5, and metabolic diseases6,7.....

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Animal experiments were conducted in accordance with the current ethical regulations for animal care and use in China.

NOTE: Animals were housed in a specific pathogen-free (SPF), controlled environment under 12-hour light and dark cycles at 25 °C. Food was irradiated before being fed to mice. Drinking water and cages were autoclaved before use. Eight-week-old male C57BL/6J mice were used in the study following 1 week of acclimatization. They were divided into several groups based on the experiment design. Each group consisted of at least three mice.

1. Gut microbiota depletion

  1. Antibiotic cocktai....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The FMT schedule used in this study is outlined in Figure 1. After treatment with the antibiotic cocktail, the efficiency of intestinal microbiota depletion was analyzed by sequencing the 16S rRNA region. We detected 196 species in the ileum of naive mice, whereas 3-day antibiotic treatment rapidly reduced the bacterial species to 35 (Figure 2A). There were eight species detected solely in mice that underwent the antibiotic cocktail treatment (

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Antibiotics used in the depletion procedure have different antibacterial properties. Vancomycin is specific for gram-positive bacteria30. Oral doxycycline can induce significant intestinal microbiota composition changes in female C57BL/6NCrl mice31. Neomycin is a broad-spectrum antibiotic that targets most gut-resident bacteria32. It does not prevent intestinal inflammation, however. Broad-spectrum antibiotic cocktails are more effective than a singl.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was carried out under the sponsor of Outstanding interdisciplinary project of West China Hospital, Sichuan University (Grant Nr: ZYJC18024) and National Natural Science Foundation of China (Grant: 81770101 and 81973540).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
5 mL syringe needleSheng guang biotech5mL
70 µm cell strainerBD biosciences352350
Ampicillin sodium saltAMERESCO0339
APC StreptavidinBD biosciences554067
Biotin anti-mouse IgA antibodyBiolegend407003
Bovine serum albiumin (BSA)SigmaB2064-50G
C57BL/6J miceChengdu Dashuo
CO2Xiyuan biotech
E.Coil genome DNATsingKe
Eppendorf tubesAxygenMCT150-C
Fast DNA stool mini HandbookQIAGEN51604
MetronidazoleShyuanyeS17079-5g
Neomycin sulfateSIGMAN-1876
Oral gavage needleYuke biotech10#
pClone007 Versatile simple TA vector kitTsingKe007VS
Phosphate Buffer Saline (PBS)HycloneSH30256
Precellys lysing kitPrecellysKT03961-1-001.2
RT PCR SYBR MIXVazymeQ411-01
SYTO BC green Fluorescent Nucleic Acid StainThermo fisher scientificS34855
V338 F primerTsingKeACTCCTACGGGAGGCAGCAG
V806 R primerTsingKeGGACTACHVGGGTWTCTAAT
Vancomycin hydrochlorideSigmaV2002
Equipments
BD FACSCalibur flow cytometerBD biosciences
Bead beater vortxScilogex
BIORAD CFX ConnectBIORAD
Centrifuge machineEppendorf
Illumina MiSeqIllumina
Nanodrop nucleic acid measurements machineThermo fisher scientific
Surgical instrumentsYuke biotech
Software
Adobe Illustrator CC 2015Version 2015
BIORAD CFX qPCR SOFTWARE
FlowJo software
Graphpad prism 7
Database
Silva (SSU132) 16S rRNA database

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Honda, K., Littman, D. R. The microbiota in adaptive immune homeostasis and disease. Nature. 535 (7610), 75-84 (2016).
  2. Weng, M. T., et al. Microbiota and gastrointestinal cancer. Journal of the Formosan Medical Association. 118 (1), 32-41 (2019).
  3. Le....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Fecal Microbiota TransplantationGut MicrobiotaIgA Coated BacteriaBacterial DepletionFlow Cytometry16S rRNA SequencingReal Time PCRIntestinal BacteriaMicrobiota Transplant ProtocolMouse Model
Video Coming Soon

Related Articles