Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

שתי שיטות לקביעת אדם תאי רירית הרחם סטרומה ראשיים מדוגמאות כריתת הרחם

Published: May 23, 2014 doi: 10.3791/51513
* These authors contributed equally

Summary

הקמת מערכות עיקריות של רירית הרחם סטרומה תא תרבות מדגימות כריתת רחם היא טכניקת ערך ביולוגית וצעד חיוני לקראת רודף מגוון רחב של מחקר שואף. כאן, אנו מתארים שתי שיטות המשמשות להקמת תרבויות סטרומה מרקמות של רירית הרחם שעברו כריתה כירורגית של חולים אנושיים.

Abstract

מאמצים רבים הוקדשו להקמת מערכות בתרבית תאים במבחנה. מערכות אלה נועדו לבנות מודל של מספר עצום של in vivo תהליכים. מערכות תרבית תאים הנובעות מדגימות של רירית הרחם אדם אינן יוצאי דופן. יישומים נעים בין תהליכים פיסיולוגיים מחזוריים רגילים לפתולוגיות של רירית הרחם כגון סרטן גינקולוגיות, מחלות זיהומיות, וליקויי פוריות. כאן, אנו מספקים שתי שיטות להקמת תאי סטרומה רירית הרחם עיקריים מדגימות כריתת רחם רירית הרחם שעברו כריתה בניתוח. השיטה הראשונה מכונה "שיטת הגירוד" ומשלבת גירוד מכאני באמצעות סכין כירורגית או גילוח ואילו בשיטה השנייה נקראת "שיטת טריפסין." שיטה זו האחרונה משתמשת בפעילות האנזימטית של טריפסין כדי לקדם את ההפרדה של תאים והעיקריים תא תולדה. אנו מדגימים המתודולוגיה צעד אחר צעד באמצעות תמונות ומיקרוסקופ דיגיטליים. אנחנו גם providדוגמאות דואר לאימות שורות תאי סטרומה רירית הרחם באמצעות תגובות כמותיים בזמן אמת שרשרת פולימרז (qPCR) וimmunofluorescence (IF).

Introduction

קורפוס הרחם האנושי מורכב משלוש שכבות, perimetrium (או serosa), myometrium, ורירית הרחם. הבחנה כל אחת משכבות אלה הוא צעד חשוב להקמת שורות תאים של רירית הרחם. Perimetrium הוא רוב השכבה החיצונית של הרחם ומורכב של תאים דקים, הצפק. Myometrium הוא השכבה העבה, באמצע של הרחם ומורכב מתאי שריר חלק. רירית הרחם מזוהה כשכבה הפנימית של הרחם וכולל אוכלוסיות האפיתל ותאים סטרומה.

רירית הרחם הוא מחולק חלוקה נוספת לשכבת basalis גזע שאוכלוסיית תאי השערה היא לאכלס מחדש את שכבת functionalis בערך כל 28 ימים 1. שכבת functionalis של רירית הרחם האנושית עוברת שינויים ביוכימיים ומורפולוגיים משמעותיים בתגובה למחזור הורמונים. הורמונים אלה נגזרים מבלוטת יותרת המוח והשחלות.

ייצור מתואם ופרסום תוצאות הורמונים במחזור רבייה. מחזור הרבייה נועד להכין את רירית הרחם לאירועי השרשת עובר פוטנציאליים. בבני אדם, מחזור הרבייה ידוע בשם "המחזור החודשי" ומחולק לשלושה שלבים - שגשוג, הפרשה, ווסת. שלב השגשוג כרוך ההתפשטות של שכבת רירית הרחם functionalis ואילו שלב ההפרשה מתאפיין בהבשלת functionalis. באופן ספציפי, שינויים תאיים, הפרשות, והתמיינות תאים לאותת השתלה פוטנציאלית. אם השתלה אינה מתרחשת לפני תום שלב ההפרשה, שכבת רירית הרחם functionalis נשפכה במהלך שלב הווסת. חשיבותה של וסת והאירועים המפעילים את שפיכת שכבת functionalis הם עדיין נדונה. בבני אדם, זה כבר מציב כי וסת היא התוצאה של אירוע אמצע הפרשה בידול שלב מסוים ידועכ" decidualization הספונטני "2. בכתב יד זה, אנו מספקים מתודולוגיה מפורטת לשתי שיטות בידוד תא סטרומה רירית הרחם, ולהשתמש בשילוב של immunofluorescence ותמונות דיגיטליות להדגים את היעילות של גישות אלה. בנוסף, אנו מיישמים את השימוש נפוץ במודל חוץ גופית של decidualization הספונטני כדי לאשר בידוד תא סטרומה רירית הרחם.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

דגימות כריתת רחם בשימוש בכתב היד הזה נאספו הקונקורדנציה עם פרוטוקול אתיקה אישר-IRB האוניברסיטה הממוספר # IRB-HSR 14424.

1. רכישה לדוגמא ממקור קליני

  1. השג ממשלה וקווים מנחים אתיים המבוסס על מוסד ותיעוד אישור לפני תחילת.
  2. לנהל את כל השלבים בתנאים סטריליים.
  3. לשמר רקמה שמקורם בחולה בתקשורת (RPMI או DMEM / גבוה גלוקוז) בצינור 50 מיליליטר ב 4 ° C, אם המדגם לא יכול להיות מעובד בתרבות באופן מיידי. דוגמאות ניתן לאחסן במצב זה לתקופה מקסימלית של 24 שעות.
  4. שטוף דגימת רקמה שלוש פעמים עם בופר פוספט סטרילי 1X (PBS) ולהשליך את הפתרון בין שוטף.

2. הכנה של שורות תאים ראשוניות בשיטת האוספות

  1. הוספת 4-10 מיליליטר של תקשורת צמיחה (RPMI או DMEM / גלוקוז גבוהה בתוספת 10% שור סרום עוברי ו -1% פניצילין, streptomyCIN) לרקמות ולהוסיף Fungizone (0.25 מיקרוגרם / מיליליטר בריכוז סופי) ל30 דקות.
  2. מחק את תקשורת הצמיחה.
  3. שטוף רקמה פעמיים עם 1X PBS.
  4. מניחים את הרקמה על צלחת תרבית תאי 6 סנטימטר להבחין בין myometrium ושכבות רירית הרחם (ראה איורים 2 א-2C לתיאור נוסף). הפרד את רירית הרחם.
  5. באמצעות להב סכין מנתחים או סכין גילוח, ויחצה את הרקמה לחתיכות קטנות תוך מגרד על צלחת תרבית תאי 6 סנטימטר. סריטות אלה להקל על ההתקשרות של תאי רירית הרחם העיקריים המתעוררים. בהשוואה לשיטת טריפסין, יש צורך יותר רקמה (ראה איור 2 ד לקירוב).
  6. בעדינות, להוסיף 2 מיליליטר של תקשורת צמיחה לצלחת שרוטה (שברי רקמה יהיו גלויים ומשותק באופן אידיאלי מתנועת הגירוד).
  7. העבר את הצלחת (ים) לחממה ייעודית תרבית תאים (37 מעלות צלזיוס, 5% CO 2). לייעד מקום לשורות תאים ראשוניים, מן othאה מנות תרבות תא. תרבויות עיקריות הן רגישות יותר להידבקות וזיהום.
  8. לבחון את התאים תחת מיקרוסקופ אור יומי. אוכלוסיות קטנות של תאים צריכים להופיע ביום שניים או שלושה מרחבי הרקמות הפרוסים (ראו איור 3 ב).
  9. כדי לשמור על תרבויות, לשטוף בעדינות עם 1X PBS ולהוסיף תקשורת טרי צמיחה (2ml) כל שלושה ימים. כאשר העלאות ריבית התפשטות, מדיה נוספת צמיחה (3-4 מיליליטר) ניתן להוסיף לצלחת 6 סנטימטר התרבות (ים).
    הערה: במהלך שינויי כביסה ותקשורת, חתיכות של רקמות צפויות להישאף. זו לא תשפיע על צמיחה של תאים חסיד. חתיכות של רקמה צריכה להישאף על ידי השלב שלאחר מכן (2.10) כמושבות חדשות צפויים לצאת אחרי שבוע אחד.
  10. כאשר צלחת 6 סנטימטר היא כ 75 - מחוברות 80% (ראה איור 3 ב), מעבר באמצעות טריפסין 0.05%. לא ניתן passaged תאים ראשוניים ללא הגבלת זמן - להקפיא את צלחת אחד מתאים בהקדם שתיים או שלוש צלחות הן maintained. אם יותר קטעים נדרשים, בצע את פרוטוקול הנצחה (הנסקרת ב נ"צ 3).

3. הכנה של שורות תאים ראשוניות בשיטת טריפסין

  1. מניחים פיסה קטנה של רקמת רירית הרחם (ראה איור 2 ד לקירוב) ב 2 מיליליטר של טריפסין 0.25% בתוספת Kanamycin (0.03 מ"ג / מיליליטר בריכוז סופי).
  2. דגירה רקמה על 37 מעלות צלזיוס במסתובבת פלטפורמה ל30 דקות.
  3. בקצרה מערבולת הרקמות.
  4. צנטריפוגה המדגם ב 200-400 XG במשך 2 דקות וזורקים supernatant.
  5. הוספת טריפסין הטרי וKanamycin.
  6. דגירה הרקמה על 37 מעלות צלזיוס בזמן מסתובב לשעה.
  7. מערבולת הרקמות ל5-10 שניות.
  8. הוספת 2ml של תקשורת צמיחה (בתוספת 10% שור סרום עוברי ו -1% פניצילין, סטרפטומיצין) כדי לבטל את טריפסין.
  9. תאי צנטריפוגה ב 200-400 XG במשך 2-3 דקות.
  10. בטל supernatant ולהוסיף 2 מיליליטר של לגדולתקשורת ה לתאי pelleted.
  11. צלחת על צלחת תרבית תאי 6 סנטימטר. מגרד את הצלחת כמו בשלב 2.5 של הכנת שורות תאים ראשוניות בשיטת האוספות הוא לא הכרחי, אבל משפר את הקובץ המצורף ותולדה של תרבויות עיקריות.
  12. לפקח על תאים תחת מיקרוסקופ אור יומי. תאים הם בדרך כלל גלויים תחת מיקרוסקופ אור לאחר 24-48 שעה (ראו איור 3 ג).
  13. כדי לשמור על התרבויות, לפקח על התאים ולשנות את התקשורת בכל 2-3 ימים כמו בשלב 2.9.
  14. למעבר התאים, השתמשו 0.05% או 0.25% טריפסין כאשר תאים מגיעים confluency 75-80% (ראה איור 3 ג).

4. שמירת רקמות נוספות לניתוח בהקפאה (הצמד ופורמלין קיבוע)

  1. שטוף מדגם פעמיים עם 1X PBS.
  2. לשאוב הרבה נוזלים ככל האפשר.
  3. להקפאת הצמד, למקם את דגימת רקמת רירית הרחם בצינור 1.7 צנטריפוגות (ראה 2F דמויות ו2G). הנח את 1.7צינור צנטריפוגות בחנקן נוזלי ל10 שניות או עד שניתן לראות שהרקמה הקפיאה למטה.
    שים לב: יש להיזהר שלא לגעת בחנקן נוזלי ישירות בעת הכנת דגימות. דוגמאות ניתן לאחסן ב -80 ° C עד עיבוד או ניתוח נוסף.
  4. לקיבעון פורמלין, לחתוך פיסה קטנה של רקמת רירית הרחם (ראה איור 2H), ולצלול ב10% פורמלין אבץ שנאגרו. לאחר 24 שעות, להשליך פורמלין ולהוסיף 70% אתנול לדגימות רקמה ועד עיבוד נוסף.

5. Immunofluorescence (IF)

  1. קיבוע תא
    1. הכן את התאים בשקופית תרבות או צלחת.
    2. בעדינות, לשטוף תאים עם 1X PBS.
    3. הוספת מתנול טרום צונן (4 מעלות צלזיוס) ואצטון (מעורבב ביחס של 1:1) במשך 5 דקות.
    4. אוויר יבש השקופית לפני שתמשיך. שקופית יכולה להיות מאוחסן על 4 מעלות צלזיוס במשך 1-2 שבועות במידת צורך.
  2. עיבוד IF
    1. רעננות תאים עם 1X PBS עבור 10 דקות. עבור עבורllowing שלבי 1-6, לנהל את כל הכביסות וincubations על פלטפורמה מסתובבת.
    2. בלוק באמצעות 1X PBS בתוספת 1% הסרום אלבומין שור (BSA) וסרום מיני 1% ספציפיים (מקור 2 nd נוגדן) ל30 דקות בטמפרטורת חדר (RT).
    3. דגירה בנוגדן ראשוני (ראה המלצות יצרנים לדילולי נוגדנים). מתייחס לחומרים לנוגדנים ספציפיים. לדלל את הנוגדן הראשוני במאגר חסימה טרי כמו בשלב 5.2.2. דגירה זה יכול להתנהל במשך לפחות שעה 2 ב RT או הלילה ב 4 ° C.
    4. לשטוף 3 פעמים עם 1X PBS במשך 5 דקות כל אחד.
    5. דגירה בנוגדנים משני (ראה המלצות יצרנים לדילולי נוגדנים). לדלל את הנוגדנים משני במאגר חסימה טרי כמו בשלב 5.2.2. כדי למנוע צילום הלבנה, חשוב לנהל את זה, והשלבים הבאים בהיעדר האור.
    6. לשטוף 3 פעמים עם 1X PBS במשך 5 דקות כל אחד.
    7. Thoroughly לייבש את השקופיות.
    8. הוסף מדיה גוברת ופתרון counterstaining DAPI.
    9. החל coverslip וסוגר את הקצוות באמצעות איטום (ים). שקופיות ניתן לאחסן ב 4 ° C בחושך עד 2 שבועות.

6. RNA חילוץ

  1. גלולה 1 x 10 7 תאים על ידי צנטריפוגה. כל החומרים וחומרים כימיים בפרוטוקול זה צריכים להיות RNase חינם.
  2. תאי Lyse במגיב 1 Trizol מיליליטר, דגירה הדגימות הומוגני ל10 דקות בטמפרטורת חדר כדי להשלים את הניתוק של מתחמי nucleoprotein.
  3. הוסף 200 μl של כלורופורם לכל 1 מיליליטר של Trizol. לנער במרץ ביד ל15 שניות ודגירה של 2-3 דקות ב RT.
  4. צנטריפוגה במהירות המרבית (15,000 XG) במשך 15 דקות ב 4 ° C. שלוש שכבות יגרמו.
  5. מעביר את השלב מימיים העליון לתוך צינור microcentrifuge טרי. הוספת גליקוגן μl 1 כדי להגדיל את תשואת RNA; עם זאת, צעד זה הוא הכרחי רק כאשר קטןכמות הרנ"א צפויה.
  6. הוסף 0.5 מיליליטר של אלכוהול לשכבה המימית, ולהפוך את הדגימות 3-5 פעמים. דגירה דגימות ב RT עבור 10 דקות. כדי להגדיל את התשואה, ניתן להציב דגימות ב-20 ° C או -80 מעלות צלזיוס למשך 30 דקות.
  7. צנטריפוגה במהירות המרבית ל10 דקות ב 4 ° C.
  8. בשלב זה, גלולה קטנה של RNA צריכה להיות גלויה. בטל supernatant.
  9. שטוף את RNA עם 1 מיליליטר של 75% אתנול.
  10. צנטריפוגה במהירות המרבית למשך 5 דקות וזורקים supernatant. ניתן לכבס דגימות פעם נוספת ללהיפטר מזהמים אורגניים, אך צעד זה אינו הכרחי.
  11. בקצרה, לייבש את גלולה RNA עד RNA גלולה היא יבשה (בדרך כלל לוקח 7-10 דק ').
    הערה: צעד נוסף אחד יכול להשתמש בו כדי להקטין את העניין אורגני ולצמצם את זמן ייבוש. לאחר השלכת supernatant מלשטוף אתנול, דגימות ספין במהירות המרבית למשך דקה נוספת ונוזל שיורי לשאוב. שים לב שלא לשאוב גלולה.
  12. לפזר RNA במי RNase ללא, תלוי בגודל של גלולה RNA. כרכים בדרך כלל נעים 10-50 μl.
  13. דגירה דגימות ב55 מעלות צלזיוס למשך 10 דקות, ולמדוד את הריכוז של רנ"א.
  14. דגימות חנות ב -20 ° C עד עיבוד נוסף.

7. הפוך תמלול

  1. להביא את RNA המדגם (1-3 מיקרוגרם) בהיקף של 9 μl עם H 2 O.
  2. RNA חום ל70 מעלות צלזיוס למשך 10 דקות.
  3. כדי ליצור תערובת הורים AMV, לשלב את ריאגנטים הבאים: 5 μl של dNTP (ריכוז עבודה של 50 מיקרומטר), 5 μl של oligos N6-DNA (ריכוז עבודה של 80 מיקרומטר), 5 μl של חיץ 5X AMV, וμl 1 של AMV . פתרון תערובת אמן זה נועד לדגימה אחת.
  4. הוספת 16 μl של מיקס מאסטר RNA המחומם. סופי עוצמת התגובה תהיה 25 תגובת μl.
  5. השתמש בתנאים הבאים PCR לשעתוק לאחור: (השלב ​​1) C ° 42 ל90 דקות, (STAge 2) 95 מעלות צלזיוס למשך 5 דקות, ו( שלב 3) 4 ° C עד עיבוד נוסף.

8. Time PCR נדל

  1. לנהל PCR תגובות באמצעות פריימרים, טמפרטורות חישול, מספרי מחזור, וחומרים כימיים הנמצאים בטבלה 1.
    שים לב: הוא אידיאלי לעקוב אחר הוראות יצרן בעת שימוש בחומרים כימיים PCR (מתייחס למספרי חברה וקטלוג בחומרים).

9. במבחנה Decidualization Protocol (נגזר 4 Ref ו5)

  1. פלייט תאי רירית הרחם.
  2. לגדול confluency של 75-85%.
  3. לאחר התאים הופכים מחוברות, לשטוף פעם אחת עם 1X PBS.
  4. במהירות, להוסיף מדיה ללא הורמון (RPMI בחינם פנול בתוספת 5% FBS רצועת פחם ו -1% פניצילין, סטרפטומיצין).
  5. לאחר 24 שעות, להוסיף מדיה הורמון חופשי בתוספת אצטט medroxyprogesterone (MPA) בריכוז סופי של 1 מיקרומטר ו8-bromoadenosine 3 ', 5'monophosphate מחזורי (cAMP) בריכוז סופי של 0.5 מ"מ.
  6. אחרי לפחות 48 שעות, לעצור את התגובה ולשמור את הצלחת (ים) לעיבוד נוסף.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כפי שהודגש בסעיף הפרוטוקול, כדי להיות בטוח לנהל את כל השיטות תחת ממשלתי, מוסדיות, וקווים המנחים אתיים בעת טיפול והכנת רקמה אנושית.

בכתב היד הזה כלול הוא איור של זרימת העבודה הכללית של "שיטת הגירוד" (איור 1 א) ואת "שיטת טריפסין" (איור 1) המשמשת להקמת תרבויות רירית הרחם ראשונית. שיטות אלה מתוארות בפירוט בסעיף הפרוטוקול (ראה חלקים - 1. 3.). שני השיטות להוכיח מוצלחות בצמיחה של רירית הרחם תרבויות עיקריות. היתרון ל" שיטת הגירוד "הוא זמן ההכנה מתקצר; עם זאת, הזמן שנדרש כדי לבחון תאי קיימא הוא בדרך כלל 2 - 4 פעמים יותר בהשוואה ל" שיטת טריפסין. "

סיפקו הם תמונות דיגיטליות של הרקמה האנושית הראשונית שהתקבלה מרכש רקמות. ניתן להבחין בין שכבות הרחם על ידיגסות של השכבה, כלומר myometrium היא עבה ושרירי ורירית הרחם דק ומניב יותר. יש לנו הדגיש את השכבה העבה, שריר החלק (myometrium) בלבן והתוויתי את שכבת רירית הרחם של עניין בשחור משני מדגמים שונים כריתת רחם (2A דמויות ו2B). באיור 2C, רקמות מכוונים עם myometrium פונה כלפי מעלה ואילו רירית הרחם נמצא בעמדה כלפי מטה. השכבה דקה, perimetrial הייתה לכרות את הגידול בניתוח ולא מודגש בתמונות הללו. כמו כן, חשוב לציין כי בגודל של השכבה של רירית הרחם בתמונות 2 ממדים הדיגיטליים אלה הוא מצג שווא כמו השכבה 3 ממדים בפועל היא דקה מאוד בהשוואה לmyometrium.

חיתוך לגודל הרקמה המתאים הוא חשוב לשני "שיטת הגירוד" ו "שיטת טריפסין." באיור 2 ד, גדלים מתאימים מיועדים לכל אחת משיטות הנ"ל לדוגמא, בהתאמה. שימוש 0.5x0 אחדחתיכת סנטימטר x0.5 .5 עבור "שיטת טריפסין" [משמאל] היא מספיקה לביסוס תרבות. רקמת המוצא הנציג ל" שיטת הגירוד "[זכות] כוללת את כל שכבות הרחם. המוצר הסופי ל" שיטת הגירוד "מיוצג באיור 2E, ומומלץ שלפחות סנטימטר 1x1x1 של רקמת רירית הרחם ישמש להקמת תרבויות ובת קיימא. הדרישה לדגימת רקמה הרבה זה חסרון של "שיטת הגירוד".

רקמות שנותר משמשות לעתים קרובות בדרכים רבות, כולל חלבון ו-RNA מנתח. על מנת להבטיח שמירה על איכות רקמה, חשוב להשתמש בשיטה "הצמד ההקפאה", כמו בסעיף הפרוטוקול (ראה 4.). שיטה זו גם באיור 2F ואיור 2G. שמירת רקמות נוספות על ידי קיבוע פורמלין היא גם מנהג נפוץ של פתולוגים וחוקרים. רקמה מתכוננת לקיבעון פורמלין מתוארת בפרוטוקול באיור 2H.

במיקרוסקופ אור היא חיונית לניטור תרבויות רירית הרחם ראשונית. תאי סטרומה רירית הרחם אדם צריכים להפגין מורפולוגיה פיברובלסטים (איור 3 א). "שיטת הגירוד" בדרך כלל יוצרת אשכולות של תאים המתעוררים מוקדם, בעיקר לאורך סריטות נגרם אזמל (איור 3 ב, יום 2). "שיטת טריפסין" מייצרת גם אשכול ודפוסי צמיחת תאים מפוזרים (איור 3 ג, יום 4). יש לנו כלל כמה תמונות מייצגות מציפוי הראשוני (יום 0) לקטע הראשון של כל שיטה (איור 3B ו 3 ג).

רקמות רבות מוגדרות על ידי הביטוי שלהם סמני רקמות ספציפיות כמו שריר אקטין חלק (SMA) לשריר חלק, CD34 בתאי גזע חיסון, וכו 'בעוד ניסויי ביטוי גנים וחלבונים שנערכו לרירית הרחם 6-11, enסמן הספציפי של תאי סטרומה dometrial עדיין לא גילה. במקום זאת, חוקרים בדרך כלל להעריך את טוהר stroma רירית הרחם על ידי מדידת סמנים ממזהמי תא פוטנציאליים. לדוגמא, סמני cytokeratin משמשים להצגת אוכלוסיות אפיתל. עם זאת, הוא פחות דאגה, כי הקמת ואחזקת epithelia רירית הרחם הוא קשה ובדרך כלל נבחר נגד (Ref 12 ואיור 4 א). אם דגימות היו שיתקבל במהלך הריון, ביטוי חיובי של HLA-A,-B,-C מדגים חיידק, תאי trophoblast 13. מצד השני, כמו fibroblasts mesenchymal האחר, תאי סטרומה רירית הרחם לבטא vimentin (CDH1). אנו מדגימים עם immunofluorescence, הביטוי של vimentin והעדר cytokeratin וcadherin E (CDH1) בתאים שלנו הוקמו רירית הרחם סטרומה (איור 4).

לבסוף, אנו מספקים ראיות פונקציונליות של תרבות רירית הרחם העיקרית באמצעות i n המבחנה assay decidualization הספונטני. שיטה זו הותאמה מ4 Ref ו -5, וכרוך בטיפול בתרבויות עם שילוב של אצטט medroxyprogesterone (MPA) ו 8 - bromoadenosine 3 ', monophosphate 5'-מחזורי (cAMP) (תאר ב9 במבחנה Decidualization פרוטוקול ודגם. באיור 5 א). בנוכחותו של MPA וcAMP, תאי סטרומה רירית הרחם תערוכת פרופילים שונים באופן משמעותי ביטוי גנים (הנסקרת ב 14 Ref). סמני decidualization ספונטניים לעתים קרובות שפורסמו הם פרולקטין (PRL) וגורם גדילה דמוי אינסולין מחייב חלבון 1 (IGFBP1) (הנסקרת ב 14 Ref). התגובה של שני הגנים האלה כדי MPA וcAMP הן אינדיקטורים חזקים של שניהם decidualization הספונטני והקמה מוצלחת של תרבות סטרומה רירית הרחם. אנו מדגימים את זה באיור 5.

ther.within-page = "תמיד"> איור 1
איור 1. סכמטי של שתי שיטות בידוד רירית הרחם ראשוניות. () מדרגה 2.1-2.10 של שיטת הגירוד מוצגת בתרשים ארגוני. (ב ') מדרגה 3.1-3.14 של שיטת טריפסין מוצגת בתרשים ארגוני. לחץ כאן לצפייה בתמונה גדולה יותר.

איור 2
איור 2. עיבוד רקמות רחם. (AC) דגימות רחם קליניות משתי מטופלות. & C נגזרות מ1 החולה ובB נגזר 2 חולה. רקמה שעברה כריתה כירורגית של הרחם (משמאל) וhighlighteשכבות רחם ד (מימין). (A & B) myometrium הוא מוקף בעיגול לבן ורירית הרחם בשחור. (C) myometrium עומד בפני המצלמה. (ד ') לדוגמה גדלי רירית הרחם נציג ראשוניים עבור שני שיטות הבידוד מצוינים. שיטת טריפסין דורשת רירית הרחם טהורה לפני תוספת של טריפסין ואילו בשיטת הגירוד יכולה משתמשת בדגימות הרחם כולו. דוגמא (E) של המדגם של רירית הרחם מעובד של שיטת הגירוד. (F & G) תמונה של רקמת רחם שנותר בהכנה לצמד הקפאה. מוצג הוא מיכל מתכת מתוצרת מעבדה מנוצל לשיטה זו. קיבעון פורמלין של מדגם של רירית הרחם (H). לחץ כאן לצפייה בתמונה גדולה יותר.

איור 3 איור 3. תמונות במיקרוסקופ אור תרבויות רירית הרחם ראשוניות. . (א) נציג תמונות של תרביות תאי רירית הרחם סטרומה נלקחו בכוחות וconfluency שונים (ב ') נציג תמונות של שיטת הגירוד (ימים 0-16) נלקחים מאותו צלחת התרבות, מופעל ב10x הערה:. קווים חזותיים מצביעות על סריטות מ להב כירורגים (ג) נציג תמונות של שיטת טריפסין.. (ימים 0-16) נלקח מאותו צלחת התרבות, מופעל ב10x לחץ כאן לצפייה בתמונה גדולה יותר.

איור 4
איור 4. תמונות Immunofluorescence של תאי סטרומה רירית הרחם. Immunofluorescence ()של תרבויות העיקריות של רירית הרחם בודד באמצעות שיטת הגירוד. תמונות להפגין אובדן cytokeratin בין הקטע 2 (P2) וקטע 5 (P5). חלבון וקמיה פרומיילוציטית (PML) חלבון גרעיני ומכתים DAPI שימשו כקבוצת ביקורת. תמונות (ב ') להפגין מכתים חיובי עבור סמן mesenchymal vimentin. תמונות גם מראות מכתים שלילי עבור E cadherin (CDH1) וcytokeratin. מכתים את DAPI וחלבון פרומיילוציטית לוקמיה (PML) סופקו שולטת. לחץ כאן לצפייה בתמונה גדולה יותר.

איור 5
איור 5. Decidualization ספונטני של שני תאי סטרומה רירית הרחם ראשוניים. () תמציתי של הליך ניסיוני. (B) upregulation של פרולקטין (PRL) וגורם גדילה דמוי אינסולין עקידת חלבון 1 ביטוי גנים (IGFBP1) בתגובה לMPA ומחנה. תוצאות נמדדו באמצעות RT-qPCR, והביטוי היה מנורמל GAPDH. משמעות חושב באמצעות סטודנטים מבחן t (P <0.001 *** וP <0.0001 ****). שני שורות התאים היו מבודדות בשיטת הגירוד. לחץ כאן לצפייה בתמונה גדולה יותר.

תחל רצף חישול בטמפרטורה (° C) מחזורים Assay
פרולקטין (PRL) קדימה CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
פרולקטין (PRL) הפוך TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
חלבון קושר פקטור גדילה דמוי אינסולין 1 (IGFBP1)קדימה TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
1 היפוך מחייב חלבון גורם גדילה דמוי אינסולין (IGFBP1) GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH לא צוין (ראה רשימה מגיב) 60 40 TaqMan

טבלת 1. תנאי PCR לסמני decidualization.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

קבוצות אחרות שתיארו והותאמו המתודולוגיה להכנת תרבויות סטרומה רירית הרחם, שרובם לנצל collagenase 4,12,13,15-18. בכתב היד הזה, שאנו מספקים מתודולוגיה וראיות לשתי שיטות עיקריות פשוטות של רירית הרחם תרבות סטרומה, אשר שניהם מנוצלים על ידי המעבדה שלנו מסיבות כלכליות והזמינות הנוחה של טריפסין ו / או סכין גילוח.

כאשר משווים את שתי השיטות שלנו, הן ליצור בהצלחה תרבויות עיקריות קיימא. השיטה המועדפת שלנו היא שיטת טריפסין כמו שיש בדרך כלל תשואה גבוהה יותר עם דרישה קטנה יותר גודל מדגם. עם זאת, אם הזמן הכנה מוגבל, שיטת הגירוד דורשת 30 דקות ואילו תאי ציפוי בשיטת טריפסין לוקח יותר משעה וחצי.

כמו כן ראוי לציון הוא שאנחנו מדגימים שיטות אלה עם דגימות כריתת רחם בניגוד לביופסיות של רירית הרחם. יו רירית הרחםpsies נלקח ללא חדירה משמעותית ונוטה לייצר דגימות קטנות יותר. ובכל זאת, בשיטות המתוארות בכתב היד הזה (במיוחד בשיטת טריפסין) אמורות להניב תרבויות מביופסיות של רירית הרחם.

ישנם יישומים רבים עבור תאי סטרומה רירית הרחם ראשוניים. השוואה בין תרבויות סטרומה רירית הרחם מאדם לעומת יונקים אחרים עשויה לספק רמזים לשאלות שכבר התווכחו במשך מאות שנים על למה בני אדם הווסת. ישנם מחקרי פיזיולוגיה נחקרו אחרים שדורשים בתרבות חוץ גופית. עניין מיוחד הן התגליות המספקות תובנות לגבי אירועי מחזור רבייה כגון ממצאים שמצאו קשר בין אירועים מולקולריים אפיגנטיים לאירועים תפקודיים של מחזור הרבייה 19,20, 21, וסקרו ב11 Ref.

רופאים יפיקו תועלת רבה מלימוד תרבות סטרומה רירית הרחם וזיהוי סמנים ביולוגייםים במקרים של הפרעות בפוריות ומחל ממאירות סרטן. בין 2006 2010, דווח כי 7.4 מ'נשים ובני זוגן השתמשו בשירותי פוריות בארצות הברית 22. אחוז משמעותי של אי פוריות הוא בגלל הכישלון של decidualization 23. יתר על כן, הקשר בין מחלות של רירית הרחם כגון היפרפלזיה ואנדומטריוזיס לפוריות הוא רק לאחרונה מוערך. היכולת ללמוד סרטן גינקולוגי רחם דרך דוגמנות במבחנה היא גם לא יסולא בפז, כי למרות שסרקומה רירית הרחם המתקדמת היא נדירה, זה יכול להיות קטלני. על ידי הקמת בתרבויות עיקריות חוץ גופית, אנחנו לומדים את ההשפעה של האירועים המולקולריים הקשורים למחלות ויכולים ליצור יישומים קליניים משוערים.

לסיכום, יצירת נציג ויעיל במודלי vivo עבור רבים של יישומים אלה היא קשה. זה הופך את הפיתוח במבחנה תרבויות רירית הרחם עיקריות ללמוד כמה in vivo פונקציות קריטיות. שתי שיטות אלה רירית הרחם הבידוד, "שיטת הגירוד" ו "שיטת טריפסין," יעזרו לספק דריסת הרגל להבנת פיזיולוגיה והפתולוגיה רירית הרחם שלנו.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לגילוי.

Acknowledgments

אנו מודים למאמצים המשותפים של ד"ר Thao דאנג וחברי המעבדה שלה לשימוש בציוד ההדמיה ומיקרוסקופ. אנו מודים גם Biorepository ומתקן רקמות מחקר ליבה (BTRF), ג'ף הרפר, והתושבים באוניברסיטת וירג'יניה שספק לנו רקמת רחם. אנו מודים קרול ה"שלאכטה לעזרה עם סכמטי סקירה.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. , 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108 (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. , Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Tags

רפואה, רחם רירית הרחם stroma רירית הרחם (עיקרי) תרבית תאים להב כירורגים טריפסין רכש רקמות decidualization ספונטני גיליון 87
שתי שיטות לקביעת אדם תאי רירית הרחם סטרומה ראשיים מדוגמאות כריתת הרחם
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jividen, K., Movassagh, M. J.,More

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

PLAYLIST

  • Research • Medicine
    Estimation of Urinary Nanocrystals in Humans using Calcium Fluorophore Labeling and Nanoparticle Tracking Analysis
  • Research • Medicine
    Development and Evaluation of 3D-Printed Cardiovascular Phantoms for Interventional Planning and Training
  • Research • Medicine
    Human Fetal Blood Flow Quantification with Magnetic Resonance Imaging and Motion Compensation
  • Research • Medicine
    Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment
  • Research • Medicine
    Segmentation and Linear Measurement for Body Composition Analysis using Slice-O-Matic and Horos
  • Research • Medicine
    Magnetic Resonance Imaging of Multiple Sclerosis at 7.0 Tesla
  • Research • Medicine
    Real-Time Magnetic Resonance Guided Focused Ultrasound for Painful Bone Metastases
  • Research • Medicine
    Isolation of Viable Adipocytes and Stromal Vascular Fraction from Human Visceral Adipose Tissue Suitable for RNA Analysis and Macrophage Phenotyping
  • Research • Medicine
    Obtaining Quality Extended Field-of-View Ultrasound Images of Skeletal Muscle to Measure Muscle Fascicle Length
  • Research • Medicine
    Lung CT Segmentation to Identify Consolidations and Ground Glass Areas for Quantitative Assesment of SARS-CoV Pneumonia
  • Research • Medicine
    Electroretinogram Recording for Infants and Children under Anesthesia to Achieve Optimal Dark Adaptation and International Standards
  • Research • Medicine
    Measurement of Tissue Oxygenation Using Near-Infrared Spectroscopy in Patients Undergoing Hemodialysis
  • Research • Medicine
    Evaluation of Capnography Sampling Line Compatibility and Accuracy when Used with a Portable Capnography Monitor
  • Research • Medicine
    Simultaneous Laryngopharyngeal and Conventional Esophageal pH Monitoring
  • Research • Medicine
    Real-Time Monitoring of Neurocritical Patients with Diffuse Optical Spectroscopies
  • Research • Neuroscience
    Evaluating Postural Control and Lower-extremity Muscle Activation in Individuals with Chronic Ankle Instability
  • Research • Medicine
    Assessment of Dependence in Activities of Daily Living Among Older Patients in an Acute Care Unit
  • Research • Medicine
    Validated LC-MS/MS Panel for Quantifying 11 Drug-Resistant TB Medications in Small Hair Samples
  • Research • Medicine
    International Expert Consensus and Recommendations for Neonatal Pneumothorax Ultrasound Diagnosis and Ultrasound-guided Thoracentesis Procedure
  • Research • Biology
    A Finite Element Approach for Locating the Center of Resistance of Maxillary Teeth
  • Research • Medicine
    Lower Limb Biomechanical Analysis of Healthy Participants
  • Research • Neuroscience
    Assessing Early Stage Open-Angle Glaucoma in Patients by Isolated-Check Visual Evoked Potential
  • Research • Medicine
    Oral Health Assessment by Lay Personnel for Older Adults
  • Research • Medicine
    Determining and Controlling External Power Output During Regular Handrim Wheelchair Propulsion
  • Research • Medicine
    A Whole Body Dosimetry Protocol for Peptide-Receptor Radionuclide Therapy (PRRT): 2D Planar Image and Hybrid 2D+3D SPECT/CT Image Methods
  • Research • Medicine
    Measurement of Carotenoids in Perifovea using the Macular Pigment Reflectometer
  • Research • Medicine
    Assessment of Static Graviceptive Perception in the Roll-Plane using the Subjective Visual Vertical Paradigm
  • Research • Medicine
    Learning Modern Laryngeal Surgery in a Dissection Laboratory
  • Research • Medicine
    DIPLOMA Approach for Standardized Pathology Assessment of Distal Pancreatectomy Specimens
  • Research • Medicine
    A Computerized Functional Skills Assessment and Training Program Targeting Technology Based Everyday Functional Skills
  • Research • Medicine
    Imaging Features of Systemic Sclerosis-Associated Interstitial Lung Disease
  • Research • Medicine
    Integrating Augmented Reality Tools in Breast Cancer Related Lymphedema Prognostication and Diagnosis
  • Research • Medicine
    Ultrasonographic Assessment During Cardiopulmonary Resuscitation
  • Research • Medicine
    Measurement of the Hepatic Venous Pressure Gradient and Transjugular Liver Biopsy
  • Research • Medicine
    Patient Directed Recording of a Bipolar Three-Lead Electrocardiogram using a Smartwatch with ECG Function
  • Research • Medicine
    Traditional Trail Making Test Modified into Brand-new Assessment Tools: Digital and Walking Trail Making Test
  • Research • Medicine
    Use of Magnetic Resonance Imaging and Biopsy Data to Guide Sampling Procedures for Prostate Cancer Biobanking
  • Research • Medicine
    A Fluorescence-based Assay for Characterization and Quantification of Lipid Droplet Formation in Human Intestinal Organoids
  • Research • Medicine
    A Novel Non-invasive Method for the Detection of Elevated Intra-compartmental Pressures of the Leg
  • Research • Medicine
    Quantitative Mapping of Specific Ventilation in the Human Lung using Proton Magnetic Resonance Imaging and Oxygen as a Contrast Agent
  • Research • Neuroscience
    Portable Thermographic Screening for Detection of Acute Wallenberg's Syndrome
  • Research • Medicine
    Use of MRI-ultrasound Fusion to Achieve Targeted Prostate Biopsy
  • Research • Medicine
    Testing of all Six Semicircular Canals with Video Head Impulse Test Systems
  • Research • Medicine
    Protocol and Guidelines for Point-of-Care Lung Ultrasound in Diagnosing Neonatal Pulmonary Diseases Based on International Expert Consensus
  • Research • Neuroscience
    Bilateral Assessment of the Corticospinal Pathways of the Ankle Muscles Using Navigated Transcranial Magnetic Stimulation
  • Research • Medicine
    Targeting Gray Rami Communicantes in Selective Chemical Lumbar Sympathectomy
  • Research • Medicine
    Multi-Modal Home Sleep Monitoring in Older Adults
  • Research • Medicine
    Cardiac Magnetic Resonance for the Evaluation of Suspected Cardiac Thrombus: Conventional and Emerging Techniques
  • Research • Medicine
    Observational Study Protocol for Repeated Clinical Examination and Critical Care Ultrasonography Within the Simple Intensive Care Studies
  • Research • Medicine
    Measurements of Motor Function and Other Clinical Outcome Parameters in Ambulant Children with Duchenne Muscular Dystrophy
  • Research • Medicine
    Assessment of the Efficacy of An Osteopathic Treatment in Infants with Biomechanical Impairments to Suckling
  • Research • Medicine
    Quantification of Levator Ani Hiatus Enlargement by Magnetic Resonance Imaging in Males and Females with Pelvic Organ Prolapse
  • Research • Medicine
    Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain
  • Research • Medicine
    Generation of Human 3D Lung Tissue Cultures (3D-LTCs) for Disease Modeling
  • Research • Medicine
    Proton Therapy Delivery and Its Clinical Application in Select Solid Tumor Malignancies
  • Research • Medicine
    Combining Volumetric Capnography And Barometric Plethysmography To Measure The Lung Structure-function Relationship
  • Research • Medicine
    Two-Dimensional X-Ray Angiography to Examine Fine Vascular Structure Using a Silicone Rubber Injection Compound
  • Research • Medicine
    Preparation, Procedures and Evaluation of Platelet-Rich Plasma Injection in the Treatment of Knee Osteoarthritis
  • Research • Medicine
    Cardiac Magnetic Resonance Imaging at 7 Tesla
  • Research • Medicine
    Semi-quantitative Assessment Using [18F]FDG Tracer in Patients with Severe Brain Injury
  • Research • Medicine
    Handheld Metal Detector Screening for Metallic Foreign Body Ingestion in Children
  • Research • Medicine
    Conducting Maximal and Submaximal Endurance Exercise Testing to Measure Physiological and Biological Responses to Acute Exercise in Humans
  • Research • Medicine
    A Metadata Extraction Approach for Clinical Case Reports to Enable Advanced Understanding of Biomedical Concepts
  • Research • Medicine
    Autonomic Function Following Concussion in Youth Athletes: An Exploration of Heart Rate Variability Using 24-hour Recording Methodology
  • Research • Medicine
    Hydra, a Computer-Based Platform for Aiding Clinicians in Cardiovascular Analysis and Diagnosis
  • Research • Medicine
    Objective Nociceptive Assessment in Ventilated ICU Patients: A Feasibility Study Using Pupillometry and the Nociceptive Flexion Reflex
  • Research • Medicine
    'Boden Food Plate': Novel Interactive Web-based Method for the Assessment of Dietary Intake
  • Research • Medicine
    Anogenital Distance and Perineal Measurements of the Pelvic Organ Prolapse (POP) Quantification System
  • Research • Medicine
    Bedside Ultrasound for Guiding Fluid Removal in Patients with Pulmonary Edema: The Reverse-FALLS Protocol
  • Research • Medicine
    Muscle Imbalances: Testing and Training Functional Eccentric Hamstring Strength in Athletic Populations
  • Research • Medicine
    Isolation of Primary Human Decidual Cells from the Fetal Membranes of Term Placentae
  • Research • Medicine
    Skeletal Muscle Neurovascular Coupling, Oxidative Capacity, and Microvascular Function with 'One Stop Shop' Near-infrared Spectroscopy
  • Research • Medicine
    Collecting Hair Samples for Hair Cortisol Analysis in African Americans
  • Research • Medicine
    In Vivo Morphometric Analysis of Human Cranial Nerves Using Magnetic Resonance Imaging in Menière's Disease Ears and Normal Hearing Ears
  • Research • Medicine
    Measuring the Carotid to Femoral Pulse Wave Velocity (Cf-PWV) to Evaluate Arterial Stiffness
  • Research • Medicine
    Standardized Measurement of Nasal Membrane Transepithelial Potential Difference (NPD)
  • Research • Medicine
    Taste Exam: A Brief and Validated Test
  • Research • Medicine
    Absorption of Nasal and Bronchial Fluids: Precision Sampling of the Human Respiratory Mucosa and Laboratory Processing of Samples
  • Research • Medicine
    Methodology for Sputum Induction and Laboratory Processing
  • Research • Medicine
    Electrophysiological Measurement of Noxious-evoked Brain Activity in Neonates Using a Flat-tip Probe Coupled to Electroencephalography
  • Research • Medicine
    A Detailed Protocol for Physiological Parameters Acquisition and Analysis in Neurosurgical Critical Patients
  • Research • Medicine
    Oral Biofilm Sampling for Microbiome Analysis in Healthy Children
  • Research • Medicine
    Using Retinal Imaging to Study Dementia
  • Research • Medicine
    Application of an Amplitude-integrated EEG Monitor (Cerebral Function Monitor) to Neonates
  • Research • Medicine
    3D Ultrasound Imaging: Fast and Cost-effective Morphometry of Musculoskeletal Tissue
  • Research • Medicine
    The 4-vessel Sampling Approach to Integrative Studies of Human Placental Physiology In Vivo
  • Research • Medicine
    A Component-resolved Diagnostic Approach for a Study on Grass Pollen Allergens in Chinese Southerners with Allergic Rhinitis and/or Asthma
  • Research • Medicine
    A Novel Method: Super-selective Adrenal Venous Sampling
  • Research • Medicine
    A Method for Quantifying Upper Limb Performance in Daily Life Using Accelerometers
  • Research • Medicine
    Non-invasive Assessments of Subjective and Objective Recovery Characteristics Following an Exhaustive Jump Protocol
  • Research • Medicine
    Experimental Protocol of a Three-minute, All-out Arm Crank Exercise Test in Spinal-cord Injured and Able-bodied Individuals
  • Research • Medicine
    Phosphorus-31 Magnetic Resonance Spectroscopy: A Tool for Measuring In Vivo Mitochondrial Oxidative Phosphorylation Capacity in Human Skeletal Muscle
  • Research • Medicine
    Assessment of Pulmonary Capillary Blood Volume, Membrane Diffusing Capacity, and Intrapulmonary Arteriovenous Anastomoses During Exercise
  • Research • Medicine
    Assessment of Child Anthropometry in a Large Epidemiologic Study
  • Research • Medicine
    Video Movement Analysis Using Smartphones (ViMAS): A Pilot Study
  • Research • Medicine
    Network Analysis of Foramen Ovale Electrode Recordings in Drug-resistant Temporal Lobe Epilepsy Patients
  • Research • Medicine
    A Model to Simulate Clinically Relevant Hypoxia in Humans
  • Research • Medicine
    Interictal High Frequency Oscillations Detected with Simultaneous Magnetoencephalography and Electroencephalography as Biomarker of Pediatric Epilepsy
  • Research • Medicine
    Induction and Assessment of Exertional Skeletal Muscle Damage in Humans
  • Research • Medicine
    A Detailed Protocol for Perspiration Monitoring Using a Novel, Small, Wireless Device
  • Research • Medicine
    Drug-Induced Sleep Endoscopy (DISE) with Target Controlled Infusion (TCI) and Bispectral Analysis in Obstructive Sleep Apnea
  • Research • Medicine
    Integrated Compensatory Responses in a Human Model of Hemorrhage
  • Research • Medicine
    Transthoracic Speckle Tracking Echocardiography for the Quantitative Assessment of Left Ventricular Myocardial Deformation
  • Research • Medicine
    Impression Cytology of the Lid Wiper Area
  • Research • Behavior
    A Protocol of Manual Tests to Measure Sensation and Pain in Humans
  • Research • Medicine
    Unbiased Deep Sequencing of RNA Viruses from Clinical Samples
  • Research • Medicine
    A Choroid Plexus Epithelial Cell-based Model of the Human Blood-Cerebrospinal Fluid Barrier to Study Bacterial Infection from the Basolateral Side
  • Research • Medicine
    Isolation and Profiling of MicroRNA-containing Exosomes from Human Bile
  • Research • Medicine
    Generation of Microtumors Using 3D Human Biogel Culture System and Patient-derived Glioblastoma Cells for Kinomic Profiling and Drug Response Testing
  • Research • Medicine
    Ultrasound Assessment of Endothelial Function: A Technical Guideline of the Flow-mediated Dilation Test
  • Research • Medicine
    Using a Laminating Technique to Perform Confocal Microscopy of the Human Sclera
  • Research • Medicine
    Intravenous Endotoxin Challenge in Healthy Humans: An Experimental Platform to Investigate and Modulate Systemic Inflammation
  • Research • Medicine
    Modeling and Simulations of Olfactory Drug Delivery with Passive and Active Controls of Nasally Inhaled Pharmaceutical Aerosols
  • Research • Medicine
    Exosomal miRNA Analysis in Non-small Cell Lung Cancer (NSCLC) Patients' Plasma Through qPCR: A Feasible Liquid Biopsy Tool
  • Research • Medicine
    A Multimodal Imaging- and Stimulation-based Method of Evaluating Connectivity-related Brain Excitability in Patients with Epilepsy
  • Research • Medicine
    Measuring Cardiac Autonomic Nervous System (ANS) Activity in Toddlers - Resting and Developmental Challenges
  • Research • Medicine
    Using Saccadometry with Deep Brain Stimulation to Study Normal and Pathological Brain Function
  • Research • Medicine
    Quantitative Fundus Autofluorescence for the Evaluation of Retinal Diseases
  • Research • Medicine
    Diagnosis of Musculus Gastrocnemius Tightness - Key Factors for the Clinical Examination
  • Research • Medicine
    Stereo-Electro-Encephalo-Graphy (SEEG) With Robotic Assistance in the Presurgical Evaluation of Medical Refractory Epilepsy: A Technical Note
  • Research • Medicine
    Quantitative Magnetic Resonance Imaging of Skeletal Muscle Disease
  • Research • Medicine
    Transcutaneous Microcirculatory Imaging in Preterm Neonates
  • Research • Medicine
    Using an Ingestible Telemetric Temperature Pill to Assess Gastrointestinal Temperature During Exercise
  • Research • Medicine
    Design, Fabrication, and Administration of the Hand Active Sensation Test (HASTe)
  • Research • Medicine
    MRI-guided dmPFC-rTMS as a Treatment for Treatment-resistant Major Depressive Disorder
  • Research • Medicine
    Functional Human Liver Preservation and Recovery by Means of Subnormothermic Machine Perfusion
  • Research • Medicine
    A Multicenter MRI Protocol for the Evaluation and Quantification of Deep Vein Thrombosis
  • Research • Medicine
    Determining The Electromyographic Fatigue Threshold Following a Single Visit Exercise Test
  • Research • Medicine
    Use of Electromagnetic Navigational Transthoracic Needle Aspiration (E-TTNA) for Sampling of Lung Nodules
  • Research • Medicine
    Trabecular Meshwork Response to Pressure Elevation in the Living Human Eye
  • Research • Medicine
    In Vivo, Percutaneous, Needle Based, Optical Coherence Tomography of Renal Masses
  • Research • Medicine
    Establishment of Human Epithelial Enteroids and Colonoids from Whole Tissue and Biopsy
  • Research • Medicine
    Human Brown Adipose Tissue Depots Automatically Segmented by Positron Emission Tomography/Computed Tomography and Registered Magnetic Resonance Images
  • Research • Medicine
    Preparation and Respirometric Assessment of Mitochondria Isolated from Skeletal Muscle Tissue Obtained by Percutaneous Needle Biopsy
  • Research • Medicine
    A Methodological Approach to Non-invasive Assessments of Vascular Function and Morphology
  • Research • Medicine
    Isolation and Immortalization of Patient-derived Cell Lines from Muscle Biopsy for Disease Modeling
  • Research • Medicine
    State of the Art Cranial Ultrasound Imaging in Neonates
  • Research • Medicine
    Measurement of Dynamic Scapular Kinematics Using an Acromion Marker Cluster to Minimize Skin Movement Artifact
  • Research • Medicine
    The Supraclavicular Fossa Ultrasound View for Central Venous Catheter Placement and Catheter Change Over Guidewire
  • Research • Medicine
    Ultrasound Assessment of Endothelial-Dependent Flow-Mediated Vasodilation of the Brachial Artery in Clinical Research
  • Research • Medicine
    Tracking the Mammary Architectural Features and Detecting Breast Cancer with Magnetic Resonance Diffusion Tensor Imaging
  • Research • Medicine
    A Neuroscientific Approach to the Examination of Concussions in Student-Athletes
  • Research • Medicine
    DTI of the Visual Pathway - White Matter Tracts and Cerebral Lesions
  • Research • Medicine
    Collection, Isolation, and Flow Cytometric Analysis of Human Endocervical Samples
  • Research • Medicine
    Fundus Photography as a Convenient Tool to Study Microvascular Responses to Cardiovascular Disease Risk Factors in Epidemiological Studies
  • Research • Medicine
    A Multi-Modal Approach to Assessing Recovery in Youth Athletes Following Concussion
  • Research • Medicine
    Clinical Assessment of Spatiotemporal Gait Parameters in Patients and Older Adults
  • Research • Medicine
    Multi-electrode Array Recordings of Human Epileptic Postoperative Cortical Tissue
  • Research • Medicine
    Collection and Extraction of Saliva DNA for Next Generation Sequencing
  • Research • Medicine
    Fast and Accurate Exhaled Breath Ammonia Measurement
  • Research • Medicine
    Developing Neuroimaging Phenotypes of the Default Mode Network in PTSD: Integrating the Resting State, Working Memory, and Structural Connectivity
  • Research • Medicine
    Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens
  • Research • Medicine
    Assessment of Vascular Function in Patients With Chronic Kidney Disease
  • Research • Medicine
    Coordinate Mapping of Hyolaryngeal Mechanics in Swallowing
  • Research • Medicine
    Network Analysis of the Default Mode Network Using Functional Connectivity MRI in Temporal Lobe Epilepsy
  • Research • Medicine
    EEG Mu Rhythm in Typical and Atypical Development
  • Research • Medicine
    The Multiple Sclerosis Performance Test (MSPT): An iPad-Based Disability Assessment Tool
  • Research • Medicine
    Isolation and Functional Characterization of Human Ventricular Cardiomyocytes from Fresh Surgical Samples
  • Research • Medicine
    Dynamic Visual Tests to Identify and Quantify Visual Damage and Repair Following Demyelination in Optic Neuritis Patients
  • Research • Medicine
    Primary Culture of Human Vestibular Schwannomas
  • Research • Medicine
    Utility of Dissociated Intrinsic Hand Muscle Atrophy in the Diagnosis of Amyotrophic Lateral Sclerosis
  • Research • Medicine
    Lesion Explorer: A Video-guided, Standardized Protocol for Accurate and Reliable MRI-derived Volumetrics in Alzheimer's Disease and Normal Elderly
  • Research • Medicine
    Pulse Wave Velocity Testing in the Baltimore Longitudinal Study of Aging
  • Research • Medicine
    Isolation, Culture, and Imaging of Human Fetal Pancreatic Cell Clusters
  • Research • Medicine
    3D-Neuronavigation In Vivo Through a Patient's Brain During a Spontaneous Migraine Headache
  • Research • Medicine
    A Novel Application of Musculoskeletal Ultrasound Imaging
  • Research • Medicine
    Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication
  • Research • Medicine
    Collecting Saliva and Measuring Salivary Cortisol and Alpha-amylase in Frail Community Residing Older Adults via Family Caregivers
  • Research • Medicine
    Diffusion Tensor Magnetic Resonance Imaging in the Analysis of Neurodegenerative Diseases
  • Research • Medicine
    Transcriptomic Analysis of Human Retinal Surgical Specimens Using jouRNAl
  • Research • Medicine
    Improved Protocol For Laser Microdissection Of Human Pancreatic Islets From Surgical Specimens
  • Research • Medicine
    Evaluation of Respiratory Muscle Activation Using Respiratory Motor Control Assessment (RMCA) in Individuals with Chronic Spinal Cord Injury
  • Research • Medicine
    Minimal Erythema Dose (MED) Testing
  • Research • Medicine
    Measuring Cardiac Autonomic Nervous System (ANS) Activity in Children
  • Research • Medicine
    Collecting And Measuring Wound Exudate Biochemical Mediators In Surgical Wounds
  • Research • Medicine
    A Research Method For Detecting Transient Myocardial Ischemia In Patients With Suspected Acute Coronary Syndrome Using Continuous ST-segment Analysis
  • Research • Medicine
    Using a Chemical Biopsy for Graft Quality Assessment
  • Research • Medicine
    Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides
  • Research • Medicine
    In Vitro Assessment of Cardiac Function Using Skinned Cardiomyocytes
  • Research • Medicine
    Normothermic Ex Situ Heart Perfusion in Working Mode: Assessment of Cardiac Function and Metabolism
  • Research • Medicine
    Evaluation of Vascular Control Mechanisms Utilizing Video Microscopy of Isolated Resistance Arteries of Rats
  • Research • Medicine
    Bronchoalveolar Lavage (BAL) for Research; Obtaining Adequate Sample Yield
  • Research • Medicine
    Non-invasive Optical Measurement of Cerebral Metabolism and Hemodynamics in Infants
  • Research • Medicine
    Tilt Testing with Combined Lower Body Negative Pressure: a "Gold Standard" for Measuring Orthostatic Tolerance
  • Research • Medicine
    Driving Simulation in the Clinic: Testing Visual Exploratory Behavior in Daily Life Activities in Patients with Visual Field Defects
  • Research • Medicine
    Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods
  • Research • Medicine
    Portable Intermodal Preferential Looking (IPL): Investigating Language Comprehension in Typically Developing Toddlers and Young Children with Autism
  • Research • Medicine
    Intraoperative Detection of Subtle Endometriosis: A Novel Paradigm for Detection and Treatment of Pelvic Pain Associated with the Loss of Peritoneal Integrity
  • Research • Medicine
    The Use of Primary Human Fibroblasts for Monitoring Mitochondrial Phenotypes in the Field of Parkinson's Disease
  • Research • Medicine
    Collection Protocol for Human Pancreas
  • Research • Medicine
    The α-test: Rapid Cell-free CD4 Enumeration Using Whole Saliva
  • Research • Medicine
    The Measurement and Treatment of Suppression in Amblyopia
  • Research • Medicine
    Corneal Donor Tissue Preparation for Endothelial Keratoplasty
  • Research • Medicine
    Quantification of Atherosclerotic Plaque Activity and Vascular Inflammation using [18-F] Fluorodeoxyglucose Positron Emission Tomography/Computed Tomography (FDG-PET/CT)
  • Research • Medicine
    Eye Tracking Young Children with Autism
  • Research • Medicine
    Doppler Optical Coherence Tomography of Retinal Circulation
  • Research • Medicine
    Utilizing Transcranial Magnetic Stimulation to Study the Human Neuromuscular System
  • Research • Medicine
    Detection and Genogrouping of Noroviruses from Children's Stools By Taqman One-step RT-PCR
  • Research • Medicine
    Method to Measure Tone of Axial and Proximal Muscle
  • Research • Medicine
    The Trier Social Stress Test Protocol for Inducing Psychological Stress
  • Research • Medicine
    Probing the Brain in Autism Using fMRI and Diffusion Tensor Imaging
  • Research • Medicine
    Multifocal Electroretinograms
  • Research • Medicine
    Isolation of Human Islets from Partially Pancreatectomized Patients
  • Research • Medicine
    Examining the Characteristics of Episodic Memory using Event-related Potentials in Patients with Alzheimer's Disease
  • Research • Medicine
    Magnetic Resonance Imaging Quantification of Pulmonary Perfusion using Calibrated Arterial Spin Labeling
  • Research • Medicine
    Manual Muscle Testing: A Method of Measuring Extremity Muscle Strength Applied to Critically Ill Patients
  • Research • Medicine
    Expired CO2 Measurement in Intubated or Spontaneously Breathing Patients from the Emergency Department
  • Research • Medicine
    A Protocol for Comprehensive Assessment of Bulbar Dysfunction in Amyotrophic Lateral Sclerosis (ALS)
  • Research • Medicine
    An Investigation of the Effects of Sports-related Concussion in Youth Using Functional Magnetic Resonance Imaging and the Head Impact Telemetry System
  • Research • Medicine
    Corneal Confocal Microscopy: A Novel Non-invasive Technique to Quantify Small Fibre Pathology in Peripheral Neuropathies
  • Research • Medicine
    Methods to Quantify Pharmacologically Induced Alterations in Motor Function in Human Incomplete SCI
  • Research • Medicine
    Multispectral Real-time Fluorescence Imaging for Intraoperative Detection of the Sentinel Lymph Node in Gynecologic Oncology
  • Research • Medicine
    Technique to Collect Fungiform (Taste) Papillae from Human Tongue
  • Research • Medicine
    Assessing Endothelial Vasodilator Function with the Endo-PAT 2000
  • Research • Medicine
    Making Sense of Listening: The IMAP Test Battery
  • Research • Medicine
    An Experimental Paradigm for the Prediction of Post-Operative Pain (PPOP)
  • Research • Biology
    Bioelectric Analyses of an Osseointegrated Intelligent Implant Design System for Amputees
  • Research • Biology
    Demonstration of Cutaneous Allodynia in Association with Chronic Pelvic Pain
  • Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter