Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens

Published: May 23, 2014 doi: 10.3791/51513
* These authors contributed equally

Summary

Establishing primary endometrial stromal cell culture systems from hysterectomy specimens is a valuable biological technique and a crucial step prior to pursuing a vast array of research aims. Here, we describe two methods used to establish stromal cultures from surgically resected endometrial tissues of human patients. 

Abstract

Many efforts have been devoted to establish in vitro cell culture systems. These systems are designed to model a vast number of in vivo processes. Cell culture systems arising from human endometrial samples are no exception. Applications range from normal cyclic physiological processes to endometrial pathologies such as gynecological cancers, infectious diseases, and reproductive deficiencies. Here, we provide two methods for establishing primary endometrial stromal cells from surgically resected endometrial hysterectomy specimens. The first method is referred to as “the scraping method” and incorporates mechanical scraping using surgical or razor blades whereas the second method is termed “the trypsin method.” This latter method uses the enzymatic activity of trypsin to promote the separation of cells and primary cell outgrowth. We illustrate step-by-step methodology through digital images and microscopy. We also provide examples for validating endometrial stromal cell lines via quantitative real time polymerase chain reactions (qPCR) and immunofluorescence (IF).

Introduction

The human uterus corpus is comprised of three layers, the perimetrium (or serosa), the myometrium, and the endometrium. Distinguishing each of these layers is an important step to establish endometrial cell lines. The perimetrium is the outer most layer of the uterus and composed of thin, serous cells. The myometrium is the thick, middle layer of the uterus and comprised of smooth muscle cells. The endometrium is identified as the inner layer of the uterus and includes epithelial and stromal cell populations.

The endometrium is further subdivided into the basalis layer whose stem cell population is hypothesized to repopulate the functionalis layer approximately every 28 days 1. The functionalis layer of the human endometrium undergoes significant biochemical and morphological changes in response to circulating hormones. These hormones are derived from the pituitary gland and the ovaries.

The coordinated production and release of hormones results in a reproductive cycle. The reproductive cycle is designed to prepare the endometrium for potential embryo implantation events. In humans, the reproductive cycle is known as “the menstrual cycle” and divided into three phases – proliferative, secretory, and menstrual. The proliferative phase involves the proliferation of the functionalis endometrial layer whereas the secretory phase is marked by functionalis maturation. Specifically, extracellular alterations, secretions, and cellular differentiation signal a potential implantation. If implantation does not occur before the end of the secretory phase, the functionalis endometrial layer is shed during the menstrual phase. The importance of menstruation and the events that trigger the shedding of the functionalis layer are still being debated. In humans, it has been posed that menstruation is the result of a specific mid-secretory phase differentiation event known as “spontaneous decidualization” 2. In this manuscript, we provide detailed methodology for both endometrial stromal cell isolation methods, and use a combination of immunofluorescence and digital images to demonstrate efficacy of these approaches. In addition, we apply a commonly used in vitro model of spontaneous decidualization to confirm endometrial stromal cell isolation.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hysterectomy specimens used in this manuscript were collected in concordance with a University IRB-approved ethics protocol numbered IRB-HSR #14424.

1. Sample Acquisition from Clinical Source

  1. Obtain government and institution-based ethical guidelines and approval documentation before beginning.
  2. Conduct all steps in sterile conditions.
  3. Preserve patient-derived tissue in media (RPMI or DMEM/High Glucose) in a 50 ml tube at 4 °C if the sample cannot be processed in culture immediately. Samples can be stored in this state for a maximum of 24 hr.
  4. Wash tissue sample three times with 1X sterile phosphate buffered saline (PBS) and discard the solution between washes.

2. Preparation of Primary Cell Lines using the Scraping Method

  1. Add 4-10 ml of growth media (RPMI or DMEM/High Glucose supplemented with 10% Fetal Bovine Serum and 1% Penicillin-streptomycin) to tissue and add Fungizone (0.25 µg/ml final concentration) for 30 min.
  2. Discard the growth media.
  3. Wash tissue twice with 1X PBS.
  4. Place the tissue on a 6 cm cell culture plate to distinguish between myometrium and endometrium layers (refer to Figures 2A-2C for further description). Separate the endometrium.
  5. Using a scalpel or razor blade, transect the tissue into small pieces while scratching onto the 6 cm cell culture dish. These scratches facilitate the attachment of the emerging primary endometrial cells. Compared to the trypsin method, more tissue is needed (see Figure 2D for an approximation).
  6. Gently, add 2 ml of growth media to scratched dish (tissue fragments will be visible and ideally immobilized from the scratching motion).
  7. Transfer the plate(s) to a designated cell culture incubator (37 °C and 5% CO2). Designate a place for primary cell lines, away from other cell culture dishes. Primary cultures are more sensitive to infection and contamination.
  8. Examine the cells under a light microscope daily. Small populations of cells should emerge by day two or three from around the sliced tissues (see Figure 3B).
  9. To maintain cultures, wash gently with 1X PBS and add fresh growth media (2ml) every three days. When proliferation rate increases, additional growth media (3-4 ml) can be added to the 6 cm culture plate(s).
    Note: During washing and media changes, pieces of tissue will likely be aspirated. This will not affect growth of adherent cells. Pieces of tissue should be aspirated by the subsequent step (2.10) as new colonies are unlikely to emerge after one week.
  10. When the 6 cm plate is approximately 75 - 80% confluent (see Figure 3B), passage using 0.05% trypsin. Primary cells cannot be passaged indefinitely - freeze down one plate of cells as soon as two or three plates are maintained. If more passages are required, follow an immortalization protocol (reviewed in Ref 3).

3. Preparation of Primary Cell Lines using the Trypsin Method

  1. Place a small piece of endometrial tissue (see Figure 2D for an approximation) in 2 ml of 0.25% trypsin supplemented with Kanamycin (0.03 mg/ml final concentration).
  2. Incubate tissue at 37 °C on rotating platform for 30 min.
  3. Briefly vortex the tissue.
  4. Centrifuge the sample at 200-400 x g for 2 min and discard the supernatant.
  5. Add fresh trypsin and Kanamycin.
  6. Incubate the tissue at 37 °C while rotating for an hr.
  7. Vortex the tissue for 5-10 sec.
  8. Add 2ml of growth media (supplemented with 10% Fetal Bovine Serum and 1% Penicillin-streptomycin) to deactivate the trypsin.
  9. Centrifuge cells at 200-400 x g for 2-3 min.
  10. Discard the supernatant and add 2 ml of growth media to the pelleted cells.
  11. Plate onto a 6 cm cell culture dish. Scraping the plate as in Step 2.5 of Preparing Primary Cell Lines using the Scraping Method is not necessary, but enhances the attachment and outgrowth of primary cultures.
  12. Monitor cells under a light microscope daily. Cells are usually visible under a light microscope after 24-48 hr (see Figure 3C).
  13. To maintain the cultures, monitor the cells and change media every 2-3 days as in Step 2.9.
  14. To passage the cells, use 0.05% or 0.25% Trypsin when cells reach 75-80% confluency (see Figure 3C).

4. Saving Extra Tissue for Analysis (Snap Freezing and Formalin Fixation)

  1. Wash sample twice with 1X PBS.
  2. Aspirate as much liquid as possible.
  3. For Snap Freezing, place endometrial tissue sample in a 1.7 centrifuge tube (see Figures 2F and 2G). Place the 1.7 centrifuge tube in liquid nitrogen for 10 sec or until it can be seen that the tissue has frozen down.
    Note: Take care not to directly touch liquid nitrogen when preparing samples. Samples can be stored at -80 °C until further processing or analysis.
  4. For formalin fixation, cut a small piece of endometrial tissue (see Figure 2H), and submerge in 10% buffered zinc formalin. After 24 hr, discard formalin and add 70% ethanol to tissue samples until further processing.

5. Immunofluorescence (IF)

  1. Cell fixation
    1. Prepare cells on a culture slide or plate.
    2. Gently, wash cells with 1X PBS.
    3. Add pre-chilled (4 °C) Methanol and Acetone (mixed at a 1:1 ratio) for 5 min.
    4. Air dry the slide before proceeding. Slide can be stored at 4 °C for 1-2 weeks if needed.
  2. Processing IF
    1. Rehydrate cells with 1X PBS for 10 min. For the following Steps 1-6, conduct all washes and incubations on a rotating platform.
    2. Block using 1X PBS supplemented with 1% Bovine Serum Albumin (BSA) and 1% species specific serum (source of 2nd antibody) for 30 min at room temperature (RT).
    3. Incubate in primary antibody (see manufacturers recommendations for antibody dilutions). Refer to Materials for specific antibodies. Dilute the primary antibody in fresh blocking buffer as in Step 5.2.2. This incubation can be conducted for at least 2 hr at RT or overnight at 4 °C.
    4. Wash 3 times with 1X PBS for 5 min each.
    5. Incubate in secondary antibody (see manufacturers recommendations for antibody dilutions). Dilute the secondary antibody in fresh blocking buffer as in Step 5.2.2. To prevent photo-bleaching, it is important to conduct this and subsequent steps in the absence of light.
    6. Wash 3 times with 1X PBS for 5 min each.
    7. Thoroughly dry the slides.
    8. Add mounting media and DAPI counterstaining solution.
    9. Apply coverslip and seal the edges using sealant(s). Slides can be stored at 4 °C in the dark for up to 2 weeks.

6. RNA Extraction

  1. Pellet 1 x 107 cells by centrifugation. All materials and reagents in this protocol should be RNAse free.
  2. Lyse cells in 1 ml TRIZOL reagent, and incubate the homogenized samples for 10 min at room temperature to complete dissociation of nucleoprotein complexes.
  3. Add 200 µl of chloroform per 1 ml of TRIZOL. Shake vigorously by hand for 15 sec and incubate for 2-3 min at RT.
  4. Centrifuge at maximum speed (15,000 x g) for 15 min at 4 °C. Three layers will result.
  5. Transfer the top aqueous phase into a fresh microcentrifuge tube. Add 1 µl glycogen to increase the RNA yield; however, this step is only necessary when a small amount of RNA is anticipated.
  6. Add 0.5 ml of isopropyl alcohol to the aqueous layer, and invert the samples 3-5 times. Incubate samples at RT for 10 min. To increase yield, samples can be placed in -20 °C or -80 °C for 30 min.
  7. Centrifuge at maximum speed for 10 min at 4 °C.
  8. At this point, a small pellet of RNA should be visible. Discard the supernatant.
  9. Wash the RNA with 1 ml of 75% ethanol.
  10. Centrifuge at maximum speed for 5 min and discard the supernatant. Samples can be washed once more to rid inorganic contaminants, but this step is not necessary.
  11. Briefly, dry the RNA pellet until RNA pellet is dry (usually takes 7-10 min).
    Note: One additional step can be used to decrease inorganic matter and decrease drying time. After discarding the supernatant from the ethanol wash, spin samples at maximum speed for an additional minute and aspirate residual liquid. Take care not to aspirate pellet.
  12. Dissolve RNA in RNase-free water, depending on the size of the RNA pellet. Volumes typically range from 10-50 µl.
  13. Incubate samples at 55 °C for 10 min, and measure the concentration of RNA.
  14. Store samples at -20 °C until further processing.

7. Reverse Transcription

  1. Bring the sample RNA (1-3 µg) to a volume of 9 µl with H2O.
  2. Heat RNA to 70 °C for 10 min.
  3. To generate an AMV master mix, combine the following reagents: 5 µl of dNTP (working concentration of 50 µM), 5 µl of N6 DNA oligos (working concentration of 80 µM), 5 µl of 5X AMV buffer, and 1 µl of AMV. This master mix solution is designed per one sample.
  4. Add 16 µl of the master mix to the heated RNA. The final reaction volume will be 25 µl reaction.
  5. Use the following PCR conditions for reverse transcription: (Stage 1) 42 °C for 90 min, (Stage 2) 95 °C for 5 min, and (Stage 3) 4 °C until further processing.

8. Real Time PCR

  1. Conduct PCR reactions using the primers, annealing temperatures, cycle numbers, and reagents found in Table 1.
    Note: It is ideal to follow manufacturer instructions when using PCR reagents (refer to company and catalog numbers in Materials).

9. In vitro Decidualization Protocol (Derived from Ref 4 and 5)

  1. Plate endometrial cells.
  2. Grow to a confluency of 75-85%.
  3. After cells become confluent, wash once with 1X PBS.
  4. Quickly, add hormone-free media (Phenol free RPMI supplemented with 5% charcoal strip FBS and 1% Penicillin-streptomycin).
  5. After 24 hr, add hormone free media supplemented with medroxyprogesterone acetate (MPA) at a final concentration of 1 µM and 8-bromoadenosine 3',5'-cyclic monophosphate (cAMP) at a final concentration of 0.5 mM.
  6. After at least 48 hr, stop the reaction and save the plate(s) for further processing.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

As emphasized in the Protocol section, be sure to conduct all methods under government, institutional, and ethical guidelines when handling and preparing human tissue.

Included in this manuscript is an illustration of the general workflow of "the scraping method" (Figure 1A) and "the trypsin method" (Figure 1B) used to establish primary endometrial cultures. These methods are described in detail in the Protocol section (see parts 1. - 3.). Both methods prove successful in the growth of primary endometrial cultures. The advantage to "the scraping method" is the shortened preparation time; however, the time it takes to observe viable cells is usually 2 - 4 times longer compared to "the trypsin method."

Provided are digital images of the initial human tissue received from tissue procurement. The uterine layers can be distinguished by the coarseness of the layer, i.e. the myometrium is thick and muscular and the endometrium is thin and more yielding. We have highlighted the thick, smooth muscle layer (myometrium) in white and outlined the endometrial layer of interest in black from two different hysterectomy samples (Figures 2A and 2B). In Figure 2C, tissues are oriented with the myometrium facing up while the endometrium is positioned down. The thin, perimetrial layer was surgically resected and not highlighted in these images. It is also important to note that the size of the endometrial layer in these digital 2-dimensional images is misrepresented as the actual 3-dimensional layer is very thin compared to the myometrium.

Cutting the appropriate tissue size is important for both "the scraping method" and "the trypsin method." In Figure 2D, appropriate sizes are designated for each method above the respective sample. Using one 0.5x0.5x0.5 cm piece for "the trypsin method" [left] is sufficient for establishing a culture. The representative starting tissue for "the scraping method" [right] includes all uterine layers. The final product for "the scraping method" is represented in Figure 2E, and it is recommended that at least 1x1x1 cm of endometrial tissue be used to establish viable cultures. The requirement for this much tissue sample is a disadvantage of "the scraping method."

Remaining tissue is often used in numerous ways including protein and RNA analyses. To ensure preservation of tissue quality, it is important to use a "snap freezing" method as in the Protocol section (see 4.). This method is also illustrated in Figure 2F and Figure 2G. Saving extra tissue by formalin fixation is also a common practice of pathologists and researchers. Preparing tissue for formalin fixation is described in the Protocol section (see 4.) and illustrated in Figure 2H.

Light microscopy is essential for monitoring primary endometrial cultures. Individual endometrial stromal cells should exhibit fibroblast morphology (Figure 3A). "The scraping method" typically generates clusters of early emerging cells, primarily along scalpel-induced scratches (Figure 3B, Day 2). "The trypsin method" generates both cluster and dispersed cell growth patterns (Figure 3C, Day 4). We have included several representative images from the initial plating (day 0) to the first passage of each method (Figure 3B and 3C).

Many tissues are defined by their expression of tissue-specific markers such as smooth muscle actin (SMA) for smooth muscle, CD34 for immune stem cells, etc. While gene and protein expression experiments have been conducted for the endometrium 6-11, an endometrial stromal cell specific marker has yet to be discovered. Instead, researchers commonly assess endometrial stroma purity by measuring markers from potential cell contaminants. For example, cytokeratin markers are used to show epithelial populations. However, it is less of a concern, because establishing and maintaining endometrial epithelia are difficult and usually selected against (Ref 12 and Figure 4A). If samples were to be obtained during pregnancy, positive expression of HLA-A, -B, -C demonstrates germ, trophoblast cells 13. On the other hand, like other mesenchymal fibroblasts, endometrial stromal cells express vimentin (CDH1). We demonstrate with immunofluorescence, the expression of vimentin and the absence of cytokeratin and E cadherin (CDH1) in our established endometrial stromal cells (Figure 4B).

Finally, we provide functional evidence of primary endometrial culture via an in vitro spontaneous decidualization assay. This method was adapted from Ref 4 and 5, and involves treatment of cultures with a combination of Medroxyprogesterone acetate (MPA) and 8- bromoadenosine 3’,5’-cyclic monophosphate (cAMP) (described in 9. In vitro Decidualization Protocol and modeled in Figure 5A). In the presence of MPA and cAMP, endometrial stromal cells exhibit significantly altered gene expression profiles (reviewed in Ref 14). The frequently published spontaneous decidualization markers are Prolactin (PRL) and Insulin-like Growth Factor Binding Protein 1 (IGFBP1) (reviewed in Ref 14). The response of these two genes to MPA and cAMP are strong indicators of both spontaneous decidualization and successful establishment of an endometrial stromal culture. We demonstrate this in Figure 5B.

Figure 1
Figure 1. Schematic of the two primary endometrial isolation methods. (A) Steps 2.1-2.10 of the scraping method displayed in an organization chart. (B) Steps 3.1-3.14 of the trypsin method displayed in an organization chart. Click here to view larger image.

Figure 2
Figure 2. Processing uterine tissue. (A-C) Clinical uterine samples from two female patients. A & C are derived from Patient 1 and B is derived from Patient 2. Surgically resected uterine tissue (left) and highlighted uterine layers (right). (A & B) The myometrium is circled in white and the endometrium in black. (C) The myometrium is facing the camera. (D) Initial representative endometrial sample sizes for both isolation methods are indicated. The trypsin method requires pure endometrium before addition of the trypsin whereas the scraping method can uses the entire uterine specimens. (E) Example of the processed endometrial sample of the scraping method. (F & G) Image of remaining uterine tissue being prepared for Snap Freezing. Shown is a lab-made metal container utilized for this method. (H) Formalin fixation of endometrial sample. Click here to view larger image.

Figure 3
Figure 3. Light microscopy images of primary endometrial cultures. (A) Representative images of endometrial stromal cell cultures taken at various powers and confluency. (B) Representative images of the scraping method (Days 0 - 16) taken of the same culture dish, powered at 10x. Note: Visual lines indicate scratches from surgical blade. (C) Representative images of the trypsin method (Days 0 - 16) taken of the same culture dish, powered at 10x. Click here to view larger image.

Figure 4
Figure 4. Immunofluorescence images of endometrial stromal cells. (A) Immunofluorescence of primary endometrial cultures isolated via the scraping method. Images demonstrate loss of cytokeratin between passage 2 (P2) and passage 5 (P5). Promyelocytic leukemia protein (PML) nuclear protein and DAPI staining were used as controls. (B) Images demonstrate positive staining for the mesenchymal marker Vimentin. Images also show negative staining for E cadherin (CDH1) and Cytokeratin. Staining for DAPI and Promyelocytic leukemia protein (PML) were provided as controls. Click here to view larger image.

Figure 5
Figure 5. Spontaneous decidualization of two primary endometrial stromal cells. (A) Outline of experimental procedure. (B) Upregulation of Prolactin (PRL) and Insulin-like Growth Factor Binding Protein 1 (IGFBP1) gene expression in response to MPA and cAMP. Results were measured via RT-qPCR, and expression was normalized to GAPDH. Significance was calculated using students t-test (P < 0.001 *** and P < 0.0001 ****). Both cell lines were isolated using the scraping method. Click here to view larger image.

Primer Sequence Annealing Temperature (°C) Cycles Assay
Prolactin (PRL) Forward CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
Prolactin (PRL) Reverse TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
Insulin-like growth factor binding protein 1 (IGFBP1) Forward TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
Insulin-like growth factor binding protein 1 (IGFBP1) Reverse GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH Unspecified (see reagent list) 60 40 Taqman

Table 1. PCR conditions for decidualization markers.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Other groups have described and adapted methodology for the preparation of endometrial stromal cultures, most of which utilize collagenase 4,12,13,15-18. In this manuscript, we have provided methodology and evidence for two simplified primary endometrial stromal culture methods, both of which are utilized by our lab for economical reasons and the convenient availability of trypsin and/or a razor blade.

When comparing our two methods, both successfully generate viable primary cultures. Our preferred method is the trypsin method as there is typically a higher yield with a smaller sample size requirement. However, if preparation time is limited, the scraping method requires 30 minutes whereas plating cells using the trypsin method takes more than an hour and a half.

Also noteworthy is that we demonstrate these methods with hysterectomy samples as opposed to endometrial biopsies. Endometrial biopsies are taken without significant intrusion and tend to produce smaller specimens. Still, the methods described in this manuscript (especially the trypsin method) should yield cultures from endometrial biopsies.

There are numerous applications for primary endometrial stromal cells. Comparing endometrial stromal cultures from human versus other mammals may provide clues to the questions that have been debated for centuries about why humans menstruate. There are other unexplored physiology studies that require in vitro culture. Of particular interest are the discoveries that provide insights into reproductive cycle events such as the findings that have linked epigenetic molecular events to the functional events of the reproductive cycle 19,20,21, and reviewed in Ref 11.

Clinicians would benefit greatly from studying endometrial stromal culture and identifying biomarkers in the instances of reproductive disorders and cancer malignancies. Between 2006 and 2010, it was reported that 7.4 million women and their partners used infertility services in the United States 22. A significant percent of infertility is due to failure of decidualization 23. Moreover, the relationship between endometrial diseases such as hyperplasia and endometriosis to infertility is only recently being assessed. The capacity to study uterine gynecological cancers through in vitro modeling is also invaluable because even though advanced endometrial sarcoma is rare, it can be lethal. By establishing in vitro primary cultures, we study the impact of the molecular events associated with the diseases and can generate putative clinical applications.

In conclusion, generating representative and efficacious in vivo models for many of these applications is difficult. This makes the development of in vitro primary endometrial cultures to study several in vivo functions critical. These two endometrial isolation methods, “the scraping method” and “the trypsin method,” will help provide the foothold for our understanding of endometrial physiology and pathology.  

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors have nothing to disclosure.

Acknowledgments

We thank the collaborative efforts of Dr. Thao Dang and members of her lab for use of their imaging and microscope equipment. We also thank the Biorepository and Tissue Research Facility (BTRF) core, Jeff Harper, and the residents at the University of Virginia for providing us with uterine tissue. We thank Karol Szlachta for the help with Schematic Overview.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. , 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108 (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. , Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Tags

Keywords: Primary Human Endometrial Stromal Cells In Vitro Cell Culture Hysterectomy Specimens Scraping Method Trypsin Method Endometrial Pathologies Gynecological Cancers Infectious Diseases Reproductive Deficiencies Quantitative Real-time PCR Immunofluorescence
Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jividen, K., Movassagh, M. J.,More

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

PLAYLIST

  • Research • Medicine
    Estimation of Urinary Nanocrystals in Humans using Calcium Fluorophore Labeling and Nanoparticle Tracking Analysis
  • Research • Medicine
    Development and Evaluation of 3D-Printed Cardiovascular Phantoms for Interventional Planning and Training
  • Research • Medicine
    Human Fetal Blood Flow Quantification with Magnetic Resonance Imaging and Motion Compensation
  • Research • Medicine
    Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment
  • Research • Medicine
    Segmentation and Linear Measurement for Body Composition Analysis using Slice-O-Matic and Horos
  • Research • Medicine
    Magnetic Resonance Imaging of Multiple Sclerosis at 7.0 Tesla
  • Research • Medicine
    Real-Time Magnetic Resonance Guided Focused Ultrasound for Painful Bone Metastases
  • Research • Medicine
    Isolation of Viable Adipocytes and Stromal Vascular Fraction from Human Visceral Adipose Tissue Suitable for RNA Analysis and Macrophage Phenotyping
  • Research • Medicine
    Obtaining Quality Extended Field-of-View Ultrasound Images of Skeletal Muscle to Measure Muscle Fascicle Length
  • Research • Medicine
    Lung CT Segmentation to Identify Consolidations and Ground Glass Areas for Quantitative Assesment of SARS-CoV Pneumonia
  • Research • Medicine
    Electroretinogram Recording for Infants and Children under Anesthesia to Achieve Optimal Dark Adaptation and International Standards
  • Research • Medicine
    Measurement of Tissue Oxygenation Using Near-Infrared Spectroscopy in Patients Undergoing Hemodialysis
  • Research • Medicine
    Evaluation of Capnography Sampling Line Compatibility and Accuracy when Used with a Portable Capnography Monitor
  • Research • Medicine
    Simultaneous Laryngopharyngeal and Conventional Esophageal pH Monitoring
  • Research • Medicine
    Real-Time Monitoring of Neurocritical Patients with Diffuse Optical Spectroscopies
  • Research • Neuroscience
    Evaluating Postural Control and Lower-extremity Muscle Activation in Individuals with Chronic Ankle Instability
  • Research • Medicine
    Assessment of Dependence in Activities of Daily Living Among Older Patients in an Acute Care Unit
  • Research • Medicine
    Validated LC-MS/MS Panel for Quantifying 11 Drug-Resistant TB Medications in Small Hair Samples
  • Research • Medicine
    International Expert Consensus and Recommendations for Neonatal Pneumothorax Ultrasound Diagnosis and Ultrasound-guided Thoracentesis Procedure
  • Research • Biology
    A Finite Element Approach for Locating the Center of Resistance of Maxillary Teeth
  • Research • Medicine
    Lower Limb Biomechanical Analysis of Healthy Participants
  • Research • Neuroscience
    Assessing Early Stage Open-Angle Glaucoma in Patients by Isolated-Check Visual Evoked Potential
  • Research • Medicine
    Oral Health Assessment by Lay Personnel for Older Adults
  • Research • Medicine
    Determining and Controlling External Power Output During Regular Handrim Wheelchair Propulsion
  • Research • Medicine
    A Whole Body Dosimetry Protocol for Peptide-Receptor Radionuclide Therapy (PRRT): 2D Planar Image and Hybrid 2D+3D SPECT/CT Image Methods
  • Research • Medicine
    Measurement of Carotenoids in Perifovea using the Macular Pigment Reflectometer
  • Research • Medicine
    Assessment of Static Graviceptive Perception in the Roll-Plane using the Subjective Visual Vertical Paradigm
  • Research • Medicine
    Learning Modern Laryngeal Surgery in a Dissection Laboratory
  • Research • Medicine
    DIPLOMA Approach for Standardized Pathology Assessment of Distal Pancreatectomy Specimens
  • Research • Medicine
    A Computerized Functional Skills Assessment and Training Program Targeting Technology Based Everyday Functional Skills
  • Research • Medicine
    Imaging Features of Systemic Sclerosis-Associated Interstitial Lung Disease
  • Research • Medicine
    Integrating Augmented Reality Tools in Breast Cancer Related Lymphedema Prognostication and Diagnosis
  • Research • Medicine
    Ultrasonographic Assessment During Cardiopulmonary Resuscitation
  • Research • Medicine
    Measurement of the Hepatic Venous Pressure Gradient and Transjugular Liver Biopsy
  • Research • Medicine
    Patient Directed Recording of a Bipolar Three-Lead Electrocardiogram using a Smartwatch with ECG Function
  • Research • Medicine
    Traditional Trail Making Test Modified into Brand-new Assessment Tools: Digital and Walking Trail Making Test
  • Research • Medicine
    Use of Magnetic Resonance Imaging and Biopsy Data to Guide Sampling Procedures for Prostate Cancer Biobanking
  • Research • Medicine
    A Fluorescence-based Assay for Characterization and Quantification of Lipid Droplet Formation in Human Intestinal Organoids
  • Research • Medicine
    A Novel Non-invasive Method for the Detection of Elevated Intra-compartmental Pressures of the Leg
  • Research • Medicine
    Quantitative Mapping of Specific Ventilation in the Human Lung using Proton Magnetic Resonance Imaging and Oxygen as a Contrast Agent
  • Research • Neuroscience
    Portable Thermographic Screening for Detection of Acute Wallenberg's Syndrome
  • Research • Medicine
    Use of MRI-ultrasound Fusion to Achieve Targeted Prostate Biopsy
  • Research • Medicine
    Testing of all Six Semicircular Canals with Video Head Impulse Test Systems
  • Research • Medicine
    Protocol and Guidelines for Point-of-Care Lung Ultrasound in Diagnosing Neonatal Pulmonary Diseases Based on International Expert Consensus
  • Research • Neuroscience
    Bilateral Assessment of the Corticospinal Pathways of the Ankle Muscles Using Navigated Transcranial Magnetic Stimulation
  • Research • Medicine
    Targeting Gray Rami Communicantes in Selective Chemical Lumbar Sympathectomy
  • Research • Medicine
    Multi-Modal Home Sleep Monitoring in Older Adults
  • Research • Medicine
    Cardiac Magnetic Resonance for the Evaluation of Suspected Cardiac Thrombus: Conventional and Emerging Techniques
  • Research • Medicine
    Observational Study Protocol for Repeated Clinical Examination and Critical Care Ultrasonography Within the Simple Intensive Care Studies
  • Research • Medicine
    Measurements of Motor Function and Other Clinical Outcome Parameters in Ambulant Children with Duchenne Muscular Dystrophy
  • Research • Medicine
    Assessment of the Efficacy of An Osteopathic Treatment in Infants with Biomechanical Impairments to Suckling
  • Research • Medicine
    Quantification of Levator Ani Hiatus Enlargement by Magnetic Resonance Imaging in Males and Females with Pelvic Organ Prolapse
  • Research • Medicine
    Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain
  • Research • Medicine
    Generation of Human 3D Lung Tissue Cultures (3D-LTCs) for Disease Modeling
  • Research • Medicine
    Proton Therapy Delivery and Its Clinical Application in Select Solid Tumor Malignancies
  • Research • Medicine
    Combining Volumetric Capnography And Barometric Plethysmography To Measure The Lung Structure-function Relationship
  • Research • Medicine
    Two-Dimensional X-Ray Angiography to Examine Fine Vascular Structure Using a Silicone Rubber Injection Compound
  • Research • Medicine
    Preparation, Procedures and Evaluation of Platelet-Rich Plasma Injection in the Treatment of Knee Osteoarthritis
  • Research • Medicine
    Cardiac Magnetic Resonance Imaging at 7 Tesla
  • Research • Medicine
    Semi-quantitative Assessment Using [18F]FDG Tracer in Patients with Severe Brain Injury
  • Research • Medicine
    Handheld Metal Detector Screening for Metallic Foreign Body Ingestion in Children
  • Research • Medicine
    Conducting Maximal and Submaximal Endurance Exercise Testing to Measure Physiological and Biological Responses to Acute Exercise in Humans
  • Research • Medicine
    A Metadata Extraction Approach for Clinical Case Reports to Enable Advanced Understanding of Biomedical Concepts
  • Research • Medicine
    Autonomic Function Following Concussion in Youth Athletes: An Exploration of Heart Rate Variability Using 24-hour Recording Methodology
  • Research • Medicine
    Hydra, a Computer-Based Platform for Aiding Clinicians in Cardiovascular Analysis and Diagnosis
  • Research • Medicine
    Objective Nociceptive Assessment in Ventilated ICU Patients: A Feasibility Study Using Pupillometry and the Nociceptive Flexion Reflex
  • Research • Medicine
    'Boden Food Plate': Novel Interactive Web-based Method for the Assessment of Dietary Intake
  • Research • Medicine
    Anogenital Distance and Perineal Measurements of the Pelvic Organ Prolapse (POP) Quantification System
  • Research • Medicine
    Bedside Ultrasound for Guiding Fluid Removal in Patients with Pulmonary Edema: The Reverse-FALLS Protocol
  • Research • Medicine
    Muscle Imbalances: Testing and Training Functional Eccentric Hamstring Strength in Athletic Populations
  • Research • Medicine
    Isolation of Primary Human Decidual Cells from the Fetal Membranes of Term Placentae
  • Research • Medicine
    Skeletal Muscle Neurovascular Coupling, Oxidative Capacity, and Microvascular Function with 'One Stop Shop' Near-infrared Spectroscopy
  • Research • Medicine
    Collecting Hair Samples for Hair Cortisol Analysis in African Americans
  • Research • Medicine
    In Vivo Morphometric Analysis of Human Cranial Nerves Using Magnetic Resonance Imaging in Menière's Disease Ears and Normal Hearing Ears
  • Research • Medicine
    Measuring the Carotid to Femoral Pulse Wave Velocity (Cf-PWV) to Evaluate Arterial Stiffness
  • Research • Medicine
    Standardized Measurement of Nasal Membrane Transepithelial Potential Difference (NPD)
  • Research • Medicine
    Taste Exam: A Brief and Validated Test
  • Research • Medicine
    Absorption of Nasal and Bronchial Fluids: Precision Sampling of the Human Respiratory Mucosa and Laboratory Processing of Samples
  • Research • Medicine
    Methodology for Sputum Induction and Laboratory Processing
  • Research • Medicine
    Electrophysiological Measurement of Noxious-evoked Brain Activity in Neonates Using a Flat-tip Probe Coupled to Electroencephalography
  • Research • Medicine
    A Detailed Protocol for Physiological Parameters Acquisition and Analysis in Neurosurgical Critical Patients
  • Research • Medicine
    Oral Biofilm Sampling for Microbiome Analysis in Healthy Children
  • Research • Medicine
    Using Retinal Imaging to Study Dementia
  • Research • Medicine
    Application of an Amplitude-integrated EEG Monitor (Cerebral Function Monitor) to Neonates
  • Research • Medicine
    3D Ultrasound Imaging: Fast and Cost-effective Morphometry of Musculoskeletal Tissue
  • Research • Medicine
    The 4-vessel Sampling Approach to Integrative Studies of Human Placental Physiology In Vivo
  • Research • Medicine
    A Component-resolved Diagnostic Approach for a Study on Grass Pollen Allergens in Chinese Southerners with Allergic Rhinitis and/or Asthma
  • Research • Medicine
    A Novel Method: Super-selective Adrenal Venous Sampling
  • Research • Medicine
    A Method for Quantifying Upper Limb Performance in Daily Life Using Accelerometers
  • Research • Medicine
    Non-invasive Assessments of Subjective and Objective Recovery Characteristics Following an Exhaustive Jump Protocol
  • Research • Medicine
    Experimental Protocol of a Three-minute, All-out Arm Crank Exercise Test in Spinal-cord Injured and Able-bodied Individuals
  • Research • Medicine
    Phosphorus-31 Magnetic Resonance Spectroscopy: A Tool for Measuring In Vivo Mitochondrial Oxidative Phosphorylation Capacity in Human Skeletal Muscle
  • Research • Medicine
    Assessment of Pulmonary Capillary Blood Volume, Membrane Diffusing Capacity, and Intrapulmonary Arteriovenous Anastomoses During Exercise
  • Research • Medicine
    Assessment of Child Anthropometry in a Large Epidemiologic Study
  • Research • Medicine
    Video Movement Analysis Using Smartphones (ViMAS): A Pilot Study
  • Research • Medicine
    Network Analysis of Foramen Ovale Electrode Recordings in Drug-resistant Temporal Lobe Epilepsy Patients
  • Research • Medicine
    A Model to Simulate Clinically Relevant Hypoxia in Humans
  • Research • Medicine
    Interictal High Frequency Oscillations Detected with Simultaneous Magnetoencephalography and Electroencephalography as Biomarker of Pediatric Epilepsy
  • Research • Medicine
    Induction and Assessment of Exertional Skeletal Muscle Damage in Humans
  • Research • Medicine
    A Detailed Protocol for Perspiration Monitoring Using a Novel, Small, Wireless Device
  • Research • Medicine
    Drug-Induced Sleep Endoscopy (DISE) with Target Controlled Infusion (TCI) and Bispectral Analysis in Obstructive Sleep Apnea
  • Research • Medicine
    Integrated Compensatory Responses in a Human Model of Hemorrhage
  • Research • Medicine
    Transthoracic Speckle Tracking Echocardiography for the Quantitative Assessment of Left Ventricular Myocardial Deformation
  • Research • Medicine
    Impression Cytology of the Lid Wiper Area
  • Research • Behavior
    A Protocol of Manual Tests to Measure Sensation and Pain in Humans
  • Research • Medicine
    Unbiased Deep Sequencing of RNA Viruses from Clinical Samples
  • Research • Medicine
    A Choroid Plexus Epithelial Cell-based Model of the Human Blood-Cerebrospinal Fluid Barrier to Study Bacterial Infection from the Basolateral Side
  • Research • Medicine
    Isolation and Profiling of MicroRNA-containing Exosomes from Human Bile
  • Research • Medicine
    Generation of Microtumors Using 3D Human Biogel Culture System and Patient-derived Glioblastoma Cells for Kinomic Profiling and Drug Response Testing
  • Research • Medicine
    Ultrasound Assessment of Endothelial Function: A Technical Guideline of the Flow-mediated Dilation Test
  • Research • Medicine
    Using a Laminating Technique to Perform Confocal Microscopy of the Human Sclera
  • Research • Medicine
    Intravenous Endotoxin Challenge in Healthy Humans: An Experimental Platform to Investigate and Modulate Systemic Inflammation
  • Research • Medicine
    Modeling and Simulations of Olfactory Drug Delivery with Passive and Active Controls of Nasally Inhaled Pharmaceutical Aerosols
  • Research • Medicine
    Exosomal miRNA Analysis in Non-small Cell Lung Cancer (NSCLC) Patients' Plasma Through qPCR: A Feasible Liquid Biopsy Tool
  • Research • Medicine
    A Multimodal Imaging- and Stimulation-based Method of Evaluating Connectivity-related Brain Excitability in Patients with Epilepsy
  • Research • Medicine
    Measuring Cardiac Autonomic Nervous System (ANS) Activity in Toddlers - Resting and Developmental Challenges
  • Research • Medicine
    Using Saccadometry with Deep Brain Stimulation to Study Normal and Pathological Brain Function
  • Research • Medicine
    Quantitative Fundus Autofluorescence for the Evaluation of Retinal Diseases
  • Research • Medicine
    Diagnosis of Musculus Gastrocnemius Tightness - Key Factors for the Clinical Examination
  • Research • Medicine
    Stereo-Electro-Encephalo-Graphy (SEEG) With Robotic Assistance in the Presurgical Evaluation of Medical Refractory Epilepsy: A Technical Note
  • Research • Medicine
    Quantitative Magnetic Resonance Imaging of Skeletal Muscle Disease
  • Research • Medicine
    Transcutaneous Microcirculatory Imaging in Preterm Neonates
  • Research • Medicine
    Using an Ingestible Telemetric Temperature Pill to Assess Gastrointestinal Temperature During Exercise
  • Research • Medicine
    Design, Fabrication, and Administration of the Hand Active Sensation Test (HASTe)
  • Research • Medicine
    MRI-guided dmPFC-rTMS as a Treatment for Treatment-resistant Major Depressive Disorder
  • Research • Medicine
    Functional Human Liver Preservation and Recovery by Means of Subnormothermic Machine Perfusion
  • Research • Medicine
    A Multicenter MRI Protocol for the Evaluation and Quantification of Deep Vein Thrombosis
  • Research • Medicine
    Determining The Electromyographic Fatigue Threshold Following a Single Visit Exercise Test
  • Research • Medicine
    Use of Electromagnetic Navigational Transthoracic Needle Aspiration (E-TTNA) for Sampling of Lung Nodules
  • Research • Medicine
    Trabecular Meshwork Response to Pressure Elevation in the Living Human Eye
  • Research • Medicine
    In Vivo, Percutaneous, Needle Based, Optical Coherence Tomography of Renal Masses
  • Research • Medicine
    Establishment of Human Epithelial Enteroids and Colonoids from Whole Tissue and Biopsy
  • Research • Medicine
    Human Brown Adipose Tissue Depots Automatically Segmented by Positron Emission Tomography/Computed Tomography and Registered Magnetic Resonance Images
  • Research • Medicine
    Preparation and Respirometric Assessment of Mitochondria Isolated from Skeletal Muscle Tissue Obtained by Percutaneous Needle Biopsy
  • Research • Medicine
    A Methodological Approach to Non-invasive Assessments of Vascular Function and Morphology
  • Research • Medicine
    Isolation and Immortalization of Patient-derived Cell Lines from Muscle Biopsy for Disease Modeling
  • Research • Medicine
    State of the Art Cranial Ultrasound Imaging in Neonates
  • Research • Medicine
    Measurement of Dynamic Scapular Kinematics Using an Acromion Marker Cluster to Minimize Skin Movement Artifact
  • Research • Medicine
    The Supraclavicular Fossa Ultrasound View for Central Venous Catheter Placement and Catheter Change Over Guidewire
  • Research • Medicine
    Ultrasound Assessment of Endothelial-Dependent Flow-Mediated Vasodilation of the Brachial Artery in Clinical Research
  • Research • Medicine
    Tracking the Mammary Architectural Features and Detecting Breast Cancer with Magnetic Resonance Diffusion Tensor Imaging
  • Research • Medicine
    A Neuroscientific Approach to the Examination of Concussions in Student-Athletes
  • Research • Medicine
    DTI of the Visual Pathway - White Matter Tracts and Cerebral Lesions
  • Research • Medicine
    Collection, Isolation, and Flow Cytometric Analysis of Human Endocervical Samples
  • Research • Medicine
    Fundus Photography as a Convenient Tool to Study Microvascular Responses to Cardiovascular Disease Risk Factors in Epidemiological Studies
  • Research • Medicine
    A Multi-Modal Approach to Assessing Recovery in Youth Athletes Following Concussion
  • Research • Medicine
    Clinical Assessment of Spatiotemporal Gait Parameters in Patients and Older Adults
  • Research • Medicine
    Multi-electrode Array Recordings of Human Epileptic Postoperative Cortical Tissue
  • Research • Medicine
    Collection and Extraction of Saliva DNA for Next Generation Sequencing
  • Research • Medicine
    Fast and Accurate Exhaled Breath Ammonia Measurement
  • Research • Medicine
    Developing Neuroimaging Phenotypes of the Default Mode Network in PTSD: Integrating the Resting State, Working Memory, and Structural Connectivity
  • Research • Medicine
    Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens
  • Research • Medicine
    Assessment of Vascular Function in Patients With Chronic Kidney Disease
  • Research • Medicine
    Coordinate Mapping of Hyolaryngeal Mechanics in Swallowing
  • Research • Medicine
    Network Analysis of the Default Mode Network Using Functional Connectivity MRI in Temporal Lobe Epilepsy
  • Research • Medicine
    EEG Mu Rhythm in Typical and Atypical Development
  • Research • Medicine
    The Multiple Sclerosis Performance Test (MSPT): An iPad-Based Disability Assessment Tool
  • Research • Medicine
    Isolation and Functional Characterization of Human Ventricular Cardiomyocytes from Fresh Surgical Samples
  • Research • Medicine
    Dynamic Visual Tests to Identify and Quantify Visual Damage and Repair Following Demyelination in Optic Neuritis Patients
  • Research • Medicine
    Primary Culture of Human Vestibular Schwannomas
  • Research • Medicine
    Utility of Dissociated Intrinsic Hand Muscle Atrophy in the Diagnosis of Amyotrophic Lateral Sclerosis
  • Research • Medicine
    Lesion Explorer: A Video-guided, Standardized Protocol for Accurate and Reliable MRI-derived Volumetrics in Alzheimer's Disease and Normal Elderly
  • Research • Medicine
    Pulse Wave Velocity Testing in the Baltimore Longitudinal Study of Aging
  • Research • Medicine
    Isolation, Culture, and Imaging of Human Fetal Pancreatic Cell Clusters
  • Research • Medicine
    3D-Neuronavigation In Vivo Through a Patient's Brain During a Spontaneous Migraine Headache
  • Research • Medicine
    A Novel Application of Musculoskeletal Ultrasound Imaging
  • Research • Medicine
    Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication
  • Research • Medicine
    Collecting Saliva and Measuring Salivary Cortisol and Alpha-amylase in Frail Community Residing Older Adults via Family Caregivers
  • Research • Medicine
    Diffusion Tensor Magnetic Resonance Imaging in the Analysis of Neurodegenerative Diseases
  • Research • Medicine
    Transcriptomic Analysis of Human Retinal Surgical Specimens Using jouRNAl
  • Research • Medicine
    Improved Protocol For Laser Microdissection Of Human Pancreatic Islets From Surgical Specimens
  • Research • Medicine
    Evaluation of Respiratory Muscle Activation Using Respiratory Motor Control Assessment (RMCA) in Individuals with Chronic Spinal Cord Injury
  • Research • Medicine
    Minimal Erythema Dose (MED) Testing
  • Research • Medicine
    Measuring Cardiac Autonomic Nervous System (ANS) Activity in Children
  • Research • Medicine
    Collecting And Measuring Wound Exudate Biochemical Mediators In Surgical Wounds
  • Research • Medicine
    A Research Method For Detecting Transient Myocardial Ischemia In Patients With Suspected Acute Coronary Syndrome Using Continuous ST-segment Analysis
  • Research • Medicine
    Using a Chemical Biopsy for Graft Quality Assessment
  • Research • Medicine
    Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides
  • Research • Medicine
    In Vitro Assessment of Cardiac Function Using Skinned Cardiomyocytes
  • Research • Medicine
    Normothermic Ex Situ Heart Perfusion in Working Mode: Assessment of Cardiac Function and Metabolism
  • Research • Medicine
    Evaluation of Vascular Control Mechanisms Utilizing Video Microscopy of Isolated Resistance Arteries of Rats
  • Research • Medicine
    Bronchoalveolar Lavage (BAL) for Research; Obtaining Adequate Sample Yield
  • Research • Medicine
    Non-invasive Optical Measurement of Cerebral Metabolism and Hemodynamics in Infants
  • Research • Medicine
    Tilt Testing with Combined Lower Body Negative Pressure: a "Gold Standard" for Measuring Orthostatic Tolerance
  • Research • Medicine
    Driving Simulation in the Clinic: Testing Visual Exploratory Behavior in Daily Life Activities in Patients with Visual Field Defects
  • Research • Medicine
    Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods
  • Research • Medicine
    Portable Intermodal Preferential Looking (IPL): Investigating Language Comprehension in Typically Developing Toddlers and Young Children with Autism
  • Research • Medicine
    Intraoperative Detection of Subtle Endometriosis: A Novel Paradigm for Detection and Treatment of Pelvic Pain Associated with the Loss of Peritoneal Integrity
  • Research • Medicine
    The Use of Primary Human Fibroblasts for Monitoring Mitochondrial Phenotypes in the Field of Parkinson's Disease
  • Research • Medicine
    Collection Protocol for Human Pancreas
  • Research • Medicine
    The α-test: Rapid Cell-free CD4 Enumeration Using Whole Saliva
  • Research • Medicine
    The Measurement and Treatment of Suppression in Amblyopia
  • Research • Medicine
    Corneal Donor Tissue Preparation for Endothelial Keratoplasty
  • Research • Medicine
    Quantification of Atherosclerotic Plaque Activity and Vascular Inflammation using [18-F] Fluorodeoxyglucose Positron Emission Tomography/Computed Tomography (FDG-PET/CT)
  • Research • Medicine
    Eye Tracking Young Children with Autism
  • Research • Medicine
    Doppler Optical Coherence Tomography of Retinal Circulation
  • Research • Medicine
    Utilizing Transcranial Magnetic Stimulation to Study the Human Neuromuscular System
  • Research • Medicine
    Detection and Genogrouping of Noroviruses from Children's Stools By Taqman One-step RT-PCR
  • Research • Medicine
    Method to Measure Tone of Axial and Proximal Muscle
  • Research • Medicine
    The Trier Social Stress Test Protocol for Inducing Psychological Stress
  • Research • Medicine
    Probing the Brain in Autism Using fMRI and Diffusion Tensor Imaging
  • Research • Medicine
    Multifocal Electroretinograms
  • Research • Medicine
    Isolation of Human Islets from Partially Pancreatectomized Patients
  • Research • Medicine
    Examining the Characteristics of Episodic Memory using Event-related Potentials in Patients with Alzheimer's Disease
  • Research • Medicine
    Magnetic Resonance Imaging Quantification of Pulmonary Perfusion using Calibrated Arterial Spin Labeling
  • Research • Medicine
    Manual Muscle Testing: A Method of Measuring Extremity Muscle Strength Applied to Critically Ill Patients
  • Research • Medicine
    Expired CO2 Measurement in Intubated or Spontaneously Breathing Patients from the Emergency Department
  • Research • Medicine
    A Protocol for Comprehensive Assessment of Bulbar Dysfunction in Amyotrophic Lateral Sclerosis (ALS)
  • Research • Medicine
    An Investigation of the Effects of Sports-related Concussion in Youth Using Functional Magnetic Resonance Imaging and the Head Impact Telemetry System
  • Research • Medicine
    Corneal Confocal Microscopy: A Novel Non-invasive Technique to Quantify Small Fibre Pathology in Peripheral Neuropathies
  • Research • Medicine
    Methods to Quantify Pharmacologically Induced Alterations in Motor Function in Human Incomplete SCI
  • Research • Medicine
    Multispectral Real-time Fluorescence Imaging for Intraoperative Detection of the Sentinel Lymph Node in Gynecologic Oncology
  • Research • Medicine
    Technique to Collect Fungiform (Taste) Papillae from Human Tongue
  • Research • Medicine
    Assessing Endothelial Vasodilator Function with the Endo-PAT 2000
  • Research • Medicine
    Making Sense of Listening: The IMAP Test Battery
  • Research • Medicine
    An Experimental Paradigm for the Prediction of Post-Operative Pain (PPOP)
  • Research • Biology
    Bioelectric Analyses of an Osseointegrated Intelligent Implant Design System for Amputees
  • Research • Biology
    Demonstration of Cutaneous Allodynia in Association with Chronic Pelvic Pain
  • Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter