Un protocolo para la evaluación funcional de la Proteína Total-mutagénesis de saturación Bibliotecas La utilización de secuenciación de alto rendimiento
Summary
Se presenta un protocolo para la evaluación funcional de amplias bibliotecas de saturación de un solo sitio de mutagénesis de proteínas utilizando secuenciación de alto rendimiento. Es importante destacar que este enfoque utiliza pares de cebadores para multiplexar ortogonales construcción de la biblioteca y secuenciación. Se proporcionan resultados representativos utilizando TEM-1 β-lactamasa seleccionado en una dosis clínicamente relevante de ampicilina.
Abstract
Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 β-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to β-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.
Introduction
Mutagénesis mucho tiempo se ha empleado en el laboratorio para estudiar las propiedades de los sistemas biológicos y su evolución, y para producir proteínas o organismos mutantes con funciones mejoradas o novedosas. Mientras que los primeros enfoques se basaban en métodos que producen mutaciones aleatorias en los organismos, el advenimiento de la tecnología del ADN recombinante permitió a los investigadores para introducir cambios en el ADN de selección de una manera específica de sitio, es decir., Mutagénesis dirigida 1,2. Con las técnicas actuales, típicamente usando oligonucleótidos mutagénicos en una reacción en cadena de la polimerasa (PCR), es relativamente fácil para crear y evaluar un número pequeño de mutaciones (por ejemplo., Mutaciones puntuales) en un gen dado 3,4. Es mucho más difícil, sin embargo, cuando los enfoques de la meta, por ejemplo, la creación de mutaciones y la evaluación de todos los posibles en un solo sitio (o de orden superior).
Aunque se ha aprendido mucho desde los primeros estudios que intentan evaluar un gran número de mutations en los genes, las técnicas utilizadas eran a menudo laborioso, por ejemplo, que requiere la evaluación de cada mutación de forma independiente mediante supresor sin sentido cepas 5-7, o estaban limitados en su capacidad cuantitativa debido a la profundidad bajo la secuenciación de Sanger 8 de secuencia. Las técnicas usadas en estos estudios han sido ampliamente suplantado por métodos que utilizan la tecnología de secuenciación de alto rendimiento 9-12. Estos enfoques conceptualmente simple implican la creación de una biblioteca que comprende un gran número de mutaciones, sometiendo la biblioteca a una pantalla o de selección de función, y luego profundo-secuenciación (es decir., Del orden de> 10 6 secuenciación lee) la biblioteca obtenida antes y después de la selección. De esta manera, los fenotípicas o la aptitud efectos de un gran número de mutaciones, representan como el cambio en la frecuencia de la población de cada mutante, puede evaluarse de forma simultánea y más cuantitativamente.
previamente hemos introducido un simp(. es decir, todo-proteína bibliotecas de mutagénesis de saturación) enfoque le para la evaluación de las bibliotecas de todas las posibles mutaciones de un solo aminoácido en las proteínas, aplicable a los genes con una longitud más larga que la secuenciación leer longitud 11,13: En primer lugar, cada posición de aminoácido es aleatorizado por PCR dirigida al sitio mutagénico. Durante este proceso, el gen se divide en grupos compuestos de posiciones contiguas con una longitud total acomodado por la plataforma de secuenciación. Los productos de PCR mutagénicos para cada grupo se combinan entonces, y cada grupo se sometieron independientemente a la selección y secuenciación de alto rendimiento. Al mantener una correspondencia entre la ubicación de las mutaciones en la secuencia y la longitud de lectura de secuenciación, este enfoque tiene la ventaja de maximizar la profundidad de secuenciación: mientras que uno puede simplemente secuenciar tales bibliotecas en ventanas cortas sin división en grupos (por ejemplo, una escopeta estándar. enfoque de secuenciación), la mayoría lee obtenido sería de tipo salvaje y por lo tanto el mayoría de rendimiento secuenciación perdido (por ejemplo, para una biblioteca de mutagénesis de saturación conjunto de proteínas de una proteína de ácido amino 500 secuenciado en 100 aminoácidos (300 pb) ventanas, como mínimo 80% de lee será la secuencia de tipo salvaje).
Aquí, un protocolo se presenta que utiliza secuenciación de alto rendimiento para la evaluación funcional de las bibliotecas de mutagénesis de saturación de toda la proteína, utilizando el enfoque anterior (descrito en la Figura 1). Es importante destacar que, se introduce el uso de cebadores ortogonales en el proceso de clonación de la biblioteca de código de barras de cada grupo de secuencias, lo que les permite ser multiplexadas en una biblioteca, se somete simultáneamente a la detección o la selección y, a continuación multiplexados DE para secuenciación profunda. Dado que los grupos de secuencias no se someten a selección de forma independiente, esto reduce la carga de trabajo y se asegura de que cada mutación experimenta el mismo nivel de selección. TEM-1 β-lactamasa, una enzima que confiere resistencia de alto nivel aantibióticos β-lactámicos (por ejemplo., ampicilina) en bacterias se utiliza como un sistema modelo 14-16. Un protocolo se describe para la evaluación de una biblioteca de mutagénesis de saturación conjunto de proteínas de TEM-1 en E. coli bajo selección en un nivel en suero aproximada para una dosis clínica de ampicilina (50 mg / ml) 17,18.
Protocol
Representative Results
Discussion
Aquí un protocolo se describe para la realización de la evaluación funcional de las bibliotecas de mutagénesis de saturación de toda la proteína, utilizando la tecnología de secuenciación de alto rendimiento. Un aspecto importante del método es la utilización de cebadores ortogonales durante el proceso de clonación. En pocas palabras, cada posición de aminoácido es al azar por PCR mutagénico, y se mezclaron conjuntamente en grupos de posiciones cuya secuencia de longitud combinada se aloja por secuenciaci?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.
Materials
| Typtone | Research Products Intl. Corp. | T60060-1000.0 | |
| Yeast extract | Research Products Intl. Corp. | Y20020-500.0 | |
| Sodium chloride | Fisher Scientific | BP358-212 | |
| Potassium chloride | Sigma-Aldrich | P9333-500G | |
| Magnesium sulfate | Sigma-Aldrich | M7506-500G | |
| Agar | Fisher Scientific | BP1423-500 | |
| Tetracycline hydrochloride | Sigma-Aldrich | T7660-5G | |
| petri plates | Corning | 351029 | |
| MATLAB | Mathworks | http://www.mathworks.com/products/matlab/ | |
| Oligonucleotide primers | Integrated DNA Technologies | https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos | 25 nmol scale, standard desalting |
| pBR322_AvrII | available upon request | pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene | |
| pBR322_OP1 – pBR322_OP5 | available upon request | five modified pBR322 plasmids each containing a pair of orthogonal priming sites | |
| Q5 high-fidelity DNA polymerase | New England Biolabs | M0491L | includes 5X PCR buffer and PCR additive (GC enhancer) |
| 15 mL conical tube | Corning | 430025 | |
| Multichannel pipettes (Eppendorf ResearchPlus) | Eppendorf | ||
| PCR plate, 96 well | Fisher Scientific | 14230232 | |
| 96 well plate seal | Excel Scientific | F-96-100 | |
| Veriti 96-well thermal cycler | Applied Biosystems | 4375786 | |
| 6X gel loading dye | New England Biolabs | B7024S | |
| Agarose | Research Products Intl. Corp. | 20090-500.0 | |
| Ethidium bromide | Bio-Rad | 161-0433 | |
| UV transilluminator (FOTO/Analyst ImageTech) | Fotodyne Inc. | http://www.fotodyne.com/content/ImageTech_gel_documentation | |
| EB buffer | Qiagen | 19086 | |
| 96-well black-walled, clear bottom assay plates | Corning | 3651 | |
| Lambda phage DNA | New England Biolabs | N3011S | |
| PicoGreen dsDNA reagent | Invitrogen | P7581 | dsDNA quantitation reagent, used in protocol step 2.2.4 |
| Victor 3V microplate reader | PerkinElmer | ||
| DNA purification kit | Zymo Research | D4003 | |
| Microcentrifuge tubes | Corning | 3621 | |
| Long-wavelength UV illuminator | Fisher Scientific | FBUVLS-80 | |
| Agarose gel DNA extraction buffer | Zymo Research | D4001-1-100 | |
| AatII | New England Biolabs | R0117S | |
| AvrII | New England Biolabs | R0174L | |
| T4 DNA ligase | New England Biolabs | M0202S | |
| EVB100 electrocompetent E. coli | Avidity | EVB100 | |
| Electroporator (E. coli Pulser) | Bio-Rad | 1652102 | |
| Electroporation cuvettes | Bio-Rad | 165-2089 | |
| Spectrophotometer (Ultrospec 3100 pro) | Amersham Biosciences | 80211237 | |
| 50 mL conical tubes | Corning | 430828 | |
| Plasmid purification kit | Macherey-Nagel | 740588.25 | |
| 8 well PCR strip tubes | Axygen | 321-10-551 | |
| Qubit dsDNA HS assay kit | Invitrogen | Q32854 | dsDNA quantitation reagent |
| Qubit assay tubes | Invitrogen | Q32856 | |
| Qubit fluorometer | Invitrogen | Q32866 | |
| Ampicillin sodium salt | Akron Biotechnology | 50824296 | |
| MiSeq reagent kit v2 (500 cycles) | Illumina | MS-102-2003 | |
| MiSeq desktop sequencer | Illumina | http://www.illumina.com/systems/miseq.html | alternatively, one could sequence on Illumina HiSeq platform |
| FLASh software | John Hopkins University – open source | http://ccb.jhu.edu/software/FLASH/ | software to merge paired-end reads from next-generation sequencing data |
| AatII_F | GATAATAATGGTTTCTTAGACGTCAGGTGGC | ||
| AvrII_R | CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG | ||
| AvrII_F | CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG | ||
| AatII_OP1_R | ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP2_R | ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP3_R | ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP4_R | ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP5_R | ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC | ||
| OP1_F | GACCGGACAGTTGAAATACG | ||
| OP1_R | CGACGTACAGGACAATTTCC | ||
| OP2_F | ATTAGTACACTCCGTGAGCG | ||
| OP2_R | AGTATTAGGCGTCAAGGTCC | ||
| OP3_F | AGTCCCAAGTTCAGACGTAC | ||
| OP3_R | GAAAAGTCCCAATGAGTGCC | ||
| OP4_F | TCACTTGGTATCGAGAACGG | ||
| OP4_R | TATCACGGAAGGACTCAACG | ||
| OP5_F | AGATTGTTACTCCGACGGAC | ||
| OP5_R | TATAACAGGCTGCTGAGACC | ||
| Group1_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC | ||
| Group1_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC | ||
| Group2_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC | ||
| Group2_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG | ||
| Group3_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC | ||
| Group3_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC | ||
| Group4_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC | ||
| Group4_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC | ||
| Group5_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC | ||
| Group5_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG | ||
| 501_F | AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC | ||
| 502_F | AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC | ||
| 503_F | AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC | ||
| 504_F | AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC | ||
| 505_F | AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC | ||
| 701_R | CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG | ||
| 702_R | CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG |
References
- Hutchison, C. A., et al. Mutagenesis at a specific position in a DNA sequence. J Biol Chem. 253 (18), 6551-6560 (1978).
- Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
- Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. Site-directed mutagenesis in one day with >80% efficiency. Strategies. 9 (3), 3-4 (1996).
- Higuchi, R., Krummel, B., Saiki, R. K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16 (15), 7351-7367 (1988).
- Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. Systematic mutation of bacteriophage T4 lysozyme. J Mol Biol. 222 (1), 67-88 (1991).
- Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as ‘spacers’ which do not require a specific sequence. J Mol Biol. 240 (5), 421-433 (1994).
- Kleina, L. G., Miller, J. H. Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors. J Mol Biol. 212 (2), 295-318 (1990).
- Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. Amino acid sequence determinants of beta-lactamase structure and activity. J Mol Biol. 258 (4), 688-703 (1996).
- Fowler, D. M., et al. High-resolution mapping of protein sequence-function relationships. Nat Methods. 7 (9), 741-746 (2010).
- Hietpas, R. T., Jensen, J. D., Bolon, D. N. Experimental illumination of a fitness landscape. Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).
- McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. The spatial architecture of protein function and adaptation. Nature. 491 (7422), 138-142 (2012).
- Deng, Z., et al. Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution. J Mol Biol. 424 (3-4), 150-167 (2012).
- Stiffler, M. A., Hekstra, D. R., Ranganathan, R. Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase. Cell. 160 (5), 882-892 (2015).
- Matagne, A., Lamotte-Brasseur, J., Frere, J. M. Catalytic properties of class A beta-lactamases: efficiency and diversity. Biochem J. 330 (Pt2), 581-598 (1998).
- Salverda, M. L., De Visser, J. A., Barlow, M. Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance. FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).
- Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. Darwinian evolution can follow only very few mutational paths to fitter proteins. Science. 312 (5770), 111-114 (2006).
- Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. Ampicillin levels in sputum, serum, and saliva. Thorax. 25 (3), 304-311 (1970).
- Giachetto, G., et al. Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia. Pediatr Infect Dis J. 23 (7), 625-629 (2004).
- Ambler, R. P., et al. A standard numbering scheme for the class A beta-lactamases. Biochem J. 276 (Pt 1), 269-270 (1991).
- Magoc, T., Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies). Bioinformatics. 27 (21), 2957-2963 (2011).
- Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein. RNA. 19 (11), 1537-1551 (2013).
- Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. A systematic survey of an intragenic epistatic landscape. Mol Biol Evol. 32 (1), 229-238 (2015).
- Dove, S. L., Joung, J. K., Hochschild, A. Activation of prokaryotic transcription through arbitrary protein-protein contacts. Nature. 386 (6625), 627-630 (1997).
- Romero, P. A., Tran, T. M., Abate, A. R. Dissecting enzyme function with microfluidic-based deep mutational scanning. Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).
