סינתזה ואפיון של prodrug אספירין-fumarate המעכבת תאי גזע סרטניים פעילות השד NFκB
Summary
This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Abstract
דלקת היא סימן היכר סרטן העומד בבסיס שכיחות סרטן וקידום, והתקדמות בסופו של דבר גרור. לפיכך, הוספת תרופה אנטי דלקתית אל גדודי סרטן תקניים לשפר את תוצאת מטופל. תרופה כזו אחת, אספירין (חומצה אצטילסליצילית, אס"א), נחקרה עבור מניעה כימית סרטן ופעילות אנטי-סרטנית. מלבד עיכוב ציר 2-פרוסטגלנדין cyclooxygenase, פעילות אנטי-סרטנית של אס"א גם יוחסו הפקטור הגרעיני ĸB (NFĸB) עיכוב. בגלל שימוש אס"א ממושך עלול לגרום לרעילויות במערכת עיכול, אסטרטגית prodrug יושמה בהצלחה. בשנת prodrug זה לעצב את חומצה קרבוקסילית של אס"א מוסווה ו pharmacophores נוספים משולבים.
פרוטוקול זה מתאר כיצד אנחנו מסונתזים prodrug fumarate האספירין, GTCpFE, ומאופיינת העיכוב של מסלול NFĸB בתאי סרטן שד ההנחתה של סרטן הגבעולי נאהעניבות, פנוטיפ NFĸB התלוי חשוב. GTCpFE ביעילות מעכבת את מסלול NFĸB בשורות תאי סרטן השד ואילו אס"א חסר כל פעילות מעכבת, המציין כי הוספת fumarate למבנה אס"א תורם באופן משמעותי את פעילותה. בנוסף, GTCpFE מראה פעילות תאי גזע נגד סרטן משמעותי על ידי חסימת היווצרות mammosphere ו משפשפים את הסרט CD44 הקשורים תא גזע סרטניים + CD24 – immunophenotype. תוצאות אלו להקים אסטרטגיה מעשית לפיתוח תרופות אנטי-דלקתיות משופרות עבור מניעה כימית וטיפול בסרטן.
Introduction
דלקת היא סימן ההיכר העומד בבסיס מגוון רחב של אספקטים tumorigenesis, כגון שכיחות וקידום, והתקדמות בסופו של דבר גרורות 1. בשנת סרטן השד, זה נתמך גם על ידי תצפיות אפידמיולוגיים מראים כי שימוש קבוע של אספירין תרופה קלאסית סטרואידיות נוגדות דלקת לא סטרואידיות (אצטיל חומצה סליצילית, אס"א) קשורה עם ירידה בשני שכיחות סרטן השד, והסיכון של גרורות והישנות 2,3. אס"א פועל בעיקר על ידי עיכוב cyclooxygenase-2 פעילות, אשר שהוגברה לעתים קרובות בסרטן השד 4,5. עם זאת, ההשפעות האנטי-סרטניות של אס"א יכול להיות גם מתווכת על ידי דיכוי κB הפקטור הגרעיני סוטה (NFκB) איתות 6-8. זה חשוב כי מסלול NFκB deregulated מקדם הישרדות תאי גידול, התפשטות, הגירה, פלישה, אנגיוגנזה, והתנגדות לטיפול 9-11. הפעלת מסלול NFκB הנה עניין מהותי הרכבה תגובה חיסונית. לכן, עבור טיפול נגד סרטן שבו עיכוב NFκB ממושך נדרש, יש לקחת בחשבון את תופעות לוואי מזיקות מעורבות לטווח ארוך דיכוי מערכת חיסוני. לפיכך, אס"א עשוי לשמש נקודת התחלה טובה עבור אופטימיזציה טיפולית.
מגבלה אחת עבור יישום אס"א בטיפול בסרטן היא במינונים הגבוהים הנדרשים cyclooxygenase 2 ועיכוב NFκB, אשר משויכים רעיל במערכת עיכול, כגון כיבים בקיבת דימום 12,13. עם זאת, המרת אס"א לתוך prodrug אסתר כמו, עשוי להפחית רעילות במערכת העיכול של אס"א. כדי לשפר עוד יותר את העוצמה ואת / או להוסיף פונקציונליות, אלמנטים מבניים נוספים או pharmacophores עזר יכול גם להיות משולב בתוך עיצוב prodrug אסתר. Pharmacophore אחד כזה הוסיף כדי לשפר אונות אס"א נגד מסלול NFκB הוא fumarate, אשר בעבר הראינו להיות חשוב עבור עיכוב מסלול NFκB 14,15.
<p class="jove_content"> אנחנו מסונתז prodrug אספירין-fumarate 15, GTCpFE, ואת שיערו כי מולקולה היברידית כזה יהיה בטוח עדיין חזקה נגד מסלול NFκB. בדקנו פעילות אנטי-NFκB שלה בתאי סרטן השד ועל יכולתה לחסום תאי גזע של סרטן השד (CSCS) 15, אשר מסתמכים על NFκB איתות עבור 16-21 הישרדות וצמיחה. אנו מוצאים כי העוצמה של GTCpFE נגד מסלול NFκB הוא השתפר באופן משמעותי על אס"א 15. בנוסף, בלוקים GTCpFE היווצרות mammosphere ו פוחתת CD44 סמן משטח CSC + CD24 – immunophenotype, המציין כי GTCpFE מסוגל בביעור CSCS 15. תוצאות אלו להקים את prodrug האספירין-fumarate כסוכן אנטי דלקתי יעיל כי גם יכול למקד CSCS שד. במונחים של טיפול בסרטן השד, GTCpFE יכול להיות פוטנציאל לטפל מחלה אגרסיבית וקטלנית.Protocol
Representative Results
Discussion
In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
Disclosures
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
Materials
| RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
| IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
| DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
| MEM NEAA 10mM 100X | Life Technologies | 11140 | |
| Penicillin Streptomycin | Life Technologies | 15140-122 | |
| L-Glutamine 100X | Life Technologies | 25030-081 | |
| Insulin | Sigma-Aldrich | I-1882 | |
| Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
| Trypsin 2.5% 10X | Invitrogen | 15090046 | |
| Methyl Cellulose | Sigma | M0262 | |
| B27 Supplement 50X | Gibco | 17504-044 | |
| EGF | Gibco | PHG0311L | |
| NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
| Renilla Luciferase Construct | Promega | pGL4.70 | |
| Lipofectamine 2000 | ThermoFisher | 11668-019 | |
| Dual-Luciferase Reporter Assay | Promega | 120000032 | |
| NanoDrop Spectrophotometer | ThermoFisher | ||
| Eppendorf Mastercycler | Eppendorf | ||
| StepOne Real Time PCR System | Thermo Scientific | ||
| Eclipse Microscope | Nikon | ||
| CyAn ADP Analyzer | Beckman Coulter | ||
| QCapture Software | QImaging | ||
| Summit Software | Beckman Coulter | ||
| GraphPad Software | Prism | ||
| TRIzol | ThermoFisher | 15596-018 | |
| M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
| 100 mM dNTP Set | Invitrogen | 10297-018 | |
| Random Hexamers | Invitrogen | 48190-011 | |
| Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
| Costar 96W, ultra low attachment | Corning | 3474 | |
| HBSS, 1X | ThermoFisher | 14025134 | |
| CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
| CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
| Recombinant Human TNFα | Fisher | 210TA100 | |
| CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
| CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
| ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
| ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
| TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
| TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
| 36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
| 36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
| Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
| 4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
| O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
| Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
| Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
| Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
| 4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
| Triethylamine | Sigma-Aldrich | T0886-100ML | |
| Toluene | Sigma-Aldrich | 244511-100ML | |
| Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
| Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
| 400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |
References
- Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
- Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
- Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
- Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
- Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
- Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
- Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
- Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
- Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
- Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
- DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
- Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
- Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
- Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
- Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
- Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
- Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
- Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer’s inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
- Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
- Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
- Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
- Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. , (2010).
- Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
- Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
- Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
- Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
- Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
- Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
- Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
- Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
- Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
- Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
- Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
- Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
- Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
- Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
- Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
- Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
- Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
- Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).
