JoVE Journal > Immunology and Infection
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Automatic Translation
Immunology and Infection

En letkøbt protokol til at generere Site-Specifically acetyleret proteiner i Escherichia Coli

Published: December 09, 2017
doi:
10.3791/57061
, , , ,
1Department of Chemistry and Biochemistry,University of Arkansas, 2Cell and Molecular Biology Program,University of Arkansas, 3Department of Biological Sciences,University of Arkansas, 4Fayetteville High School

Summary

Genetiske kode ekspansion fungerer som et effektivt redskab til at studere en bred vifte af biologiske processer, herunder protein acetylation. Her viser vi en letkøbt protokol til at udnytte denne teknik til at generere administrationsprocedurerne acetyleret proteiner på bestemte steder i Escherichia coli celler.

Abstract

Posttranslationelle modifikationer, der finder sted på specifikke positioner af proteiner har vist sig at spille en vigtig rolle i en række forskellige cellulære processer. Blandt dem er Vendbar lysin acetylation en af de mest udbredte distribueret i alle områder af livet. Selv om talrige massespektrometri-baseret acetylome undersøgelser har været udført, har yderligere karakterisering af disse formodede acetylation mål været begrænset. En mulig årsag er, at det er vanskeligt at generere rent acetyleret proteiner på ønskede positioner ved de fleste klassiske biokemiske metoder. For at overvinde denne udfordring, er den genetiske kode ekspansion teknik blevet anvendt til at bruge par en manipuleret pyrrolysyl-tRNA syntetase variant, og dens beslægtet tRNA fra Methanosarcinaceae arter, til direkte cotranslational indarbejdelse af acetyllysine på det specifikke websted i protein af interesse. Efter første anvendelse i studiet af Histon acetylation, har denne tilgang lettet acetylation studier på en række proteiner. I dette arbejde viste vi en letkøbt protokol for at producere site-specifically acetyleret proteiner ved hjælp af model bakterien Escherichia coli som vært. Malat-dehydrogenase blev brugt som en demonstration eksempel i dette arbejde.

Introduction

Posttranslationelle modifikationer (PTMs) af proteiner opstår efter oversættelsesprocessen og opstå fra kovalente tilsætning af funktionelle grupper til aminosyrerester, spiller vigtige roller i næsten alle de biologiske processer, herunder gen transskription, stressrespons, Celledifferentiering og metabolisme1,2,3. Til dato, omkring 400 markante er PTMs blevet identificeret4. Indviklet i genomet og proteomet forstærkes i stor udstrækning af protein PTMs, da de regulere protein aktivitet og lokalisering, og påvirke samspillet med andre molekyler som proteiner, nukleinsyrer, lipider og cofaktorer5.

Protein acetylation har været på forkant med PTMs undersøgelser i de sidste to årtier6,7,8,9,10,11,12. Lysin acetylation blev først opdaget i histonerne mere end 50 år siden13,14, har været godt undersøgt, og er kendt for at eksistere i mere end 80 transkriptionsfaktorer, lovgivere og forskellige proteiner15, 16,17. Undersøgelser på protein acetylation har ikke kun givet os en dybere forståelse af sin reguleringsmekanismer, men også guidet behandlinger for en række sygdomme forårsaget af dysfunktionelle acetylation18,19, 20 , 21 , 22 , 23. man mente at lysin acetylation kun sker i eukaryoter, men nylige undersøgelser har vist, at protein acetylation også spiller vigtige roller i bakteriel fysiologi, herunder chemotaxis, syre modstand, aktivering og stabilisering af sygdomsfremkaldende evne øer og andre virulens relaterede proteiner24,25,26,27,28,29.

En almindeligt anvendt metode til biokemisk karakterisere lysin acetylation bruger site-directed mutagenese. Glutamin er brugt som en efterligner af acetyllysine på grund af dens lignende størrelse og polaritet. Arginin er udnyttet som en ikke-acetyleret lysin efterligner, da den bevarer sin positive ladning fysiologiske betingelser, men kan ikke være acetyleret. Men begge efterligner er ikke rigtig isosteres og altid give ikke de forventede resultater30. Den mest stringent tilgang er at generere administrationsprocedurerne acetyleret proteiner på specifikke lysin rester, som er vanskeligt eller umuligt for mest klassiske metoder på grund af den lave støkiometrisk af lysin acetylation i naturen7,11. Denne udfordring har været bragt i orden af den genetiske kode ekspansionsstrategi, som beskæftiger en manipuleret pyrrolysyl-tRNA syntetase variant fra Methanosarcinaceae arter at oplade tRNAPyl med acetyllysine, udnytter værten Translationel maskiner til at undertrykke UAG stop codon i mRNA, og dirigerer indarbejdelse af acetyllysine i positionen designet af target protein31. For nylig har vi optimeret dette system med en forbedret EF-Tu-bindende tRNA32 og en opgraderet acetyllysyl-tRNA syntetase33. Derudover har vi anvendt denne forbedrede vedtægter system i acetylation undersøgelser af malat dehydrogenase34 og tyrosyl-tRNA syntetase35. Heri, vise vi protokol til at generere rent acetyleret proteiner fra de molekylære kloning til biokemiske identifikation ved hjælp af malat-dehydrogenase (MDH), som vi har grundigt undersøgt som en demonstrativ eksempel.

Protocol

1. site-Directed mutagenese af Target gen Bemærk: MDH udtrykkes T7 promotor i pCDF-1 vektor med CloDF13 oprindelse og en kopi antallet af 20-4034. Indføre rav stop-codon på position 140 i genet af primere (videresende primer: GGTGTTTATGACTAGAACAAACTGTTCGGCG og vende primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), efter instruktion af site-directed mutagenese kit. Forstærke den skabelon plasmid indeholdende vildtype mal…

Representative Results

Udbyttet af acetyleret MDH protein var 15 mg per 1 L kultur, mens der i wild-type MDH var 31 mg per 1 L kultur. Renset proteiner blev analyseret af SDS-PAGE som vist i figur 1. Wild-type MDH blev brugt som en positiv kontrol34. Protein renset fra celler husly acetyllysine (AcK) iblanding system og mutant mdh gen, men uden AcK i vækst medier, blev brugt som en negativ kontrol. Lysin acetylation af renset proteiner blev opdaget…

Discussion

Den genetiske indarbejdelse af noncanonical aminosyrer (ncAAs) er baseret på undertrykkelse af en tildelt codon, for det meste rav stop codon UAG36,37,38,39, af den ncAA-opkrævet tRNA indeholdende den tilsvarende anticodon. Som det er kendt, UAG-codon er anerkendt af release faktor-1 (RF1) i bakterier, og det kan også være undertrykt af nær beslægtet tRNAer fra værter opkrævet af canoni…

Disclosures

The authors have nothing to disclose.

Acknowledgements

Dette arbejde blev støttet af NIH (AI119813), opstart fra University of Arkansas, og prisen fra Arkansas Biosciences Institute.

Materials

Bradford protein assay Bio-Rad 5000006 Protein concentration
4x Laemmli Sample Buffer Bio-Rad 1610747 SDS sample buffer
Coomassie G-250 Stain Bio-Rad 1610786 SDS-PAGE gel staining
4-20% SDS-PAGE ready gel Bio-Rad 4561093 Protein determination
Ac-K-100 (HRP Conjugate) Cell Signaling 6952 Antibody
IPTG CHEM-IMPEX 194 Expression inducer
Nε-Acetyl-L-lysine CHEM-IMPEX 5364 Noncanonical amino acid
PD-10 desalting column GE Healthcare 17085101 Desalting
Q5 Site-Directed Mutagenesis Kit NEB E0554 Introducing the stop codon
BL21 (DE3) cells NEB C2527 Expressing strain
QIAprep Spin Miniprep Kit QIAGEN 27106 Extracting plasmids
Ni-NTA resin QIAGEN 30210 Affinity purification resin
nicotinamide Sigma-Aldrich N3376 Deacetylase inhibitor
β-Mercaptoethanol Sigma-Aldrich M6250 Reducing agent
BugBuster Protein Extraction Reagent Sigma-Aldrich 70584 Breaking cells
Benzonase nuclease Sigma-Aldrich E1014 DNase
ECL Western Blotting Substrate ThermoFisher 32106 Chemiluminescence
Premixed LB Broth VWR 97064 Cell growth medium
Bovine serum albumin VWR 97061-416 western blots blocking
DOWNLOAD MATERIALS LIST

References

  1. Krishna, R. G., Wold, F. Post-translational modification of proteins. Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).
  2. Lothrop, A. P., Torres, M. P., Fuchs, S. M. Deciphering post-translational modification codes. FEBS Lett. 587 (8), 1247-1257 (2013).
  3. Walsh, C. T. . Posttranslational modification of proteins : expanding nature’s inventory. , (2006).
  4. Khoury, G. A., Baliban, R. C., Floudas, C. A. Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep. 1, (2011).
  5. Grotenbreg, G., Ploegh, H. Chemical biology: dressed-up proteins. Nature. 446 (7139), 993-995 (2007).
  6. Arif, M., Selvi, B. R., Kundu, T. K. Lysine acetylation: the tale of a modification from transcription regulation to metabolism. Chembiochem. 11 (11), 1501-1504 (2010).
  7. Cohen, T., Yao, T. P. AcK-knowledge reversible acetylation. Science’s STKE : signal transduction knowledge environment. (245), pe42 (2004).
  8. Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. The world of protein acetylation. Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).
  9. Escalante-Semerena, J. C. Nε-acetylation control conserved in all three life domains. Microbe. 5, 340-344 (2010).
  10. Kouzarides, T. Acetylation: a regulatory modification to rival phosphorylation?. The EMBO journal. 19 (6), 1176-1179 (2000).
  11. Soppa, J. Protein acetylation in archaea, bacteria, and eukaryotes. Archaea. , (2010).
  12. Verdin, E., Ott, M. 50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond. Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).
  13. Allfrey, V. G., Faulkner, R., Mirsky, A. E. Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis. P Natl Acad Sci USA. 51, 786-794 (1964).
  14. Phillips, D. M. The presence of acetyl groups of histones. Biochem j. 87, 258-263 (1963).
  15. Sterner, D. E., Berger, S. L. Acetylation of histones and transcription-related factors. Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).
  16. Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. Acetylation and deacetylation of non-histone proteins. Gene. 363, 15-23 (2005).
  17. Close, P., et al. The emerging role of lysine acetylation of non-nuclear proteins. Cell Mol Life Sci. 67 (8), 1255-1264 (2010).
  18. Iyer, A., Fairlie, D. P., Brown, L. Lysine acetylation in obesity, diabetes and metabolic disease. Immunol Cell Biol. 90 (1), 39-46 (2012).
  19. You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. Lysine acetylation: enzymes, bromodomains and links to different diseases. Essays Biochem. 52, 1-12 (2012).
  20. Bonnaud, E. M., Suberbielle, E., Malnou, C. E. Histone acetylation in neuronal (dys)function. Biomol Concepts. 7 (2), 103-116 (2016).
  21. Fukushima, A., Lopaschuk, G. D. Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure. Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).
  22. Kaypee, S., et al. Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics. Pharmacol Ther. 162, 98-119 (2016).
  23. Tapias, A., Wang, Z. Q. Lysine Acetylation and Deacetylation in Brain Development and Neuropathies. Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).
  24. Hu, L. I., Lima, B. P., Wolfe, A. J. Bacterial protein acetylation: the dawning of a new age. Molecular microbiology. 77 (1), 15-21 (2010).
  25. Jones, J. D., O’Connor, C. D. Protein acetylation in prokaryotes. Proteomics. 11 (15), 3012-3022 (2011).
  26. Bernal, V., et al. Regulation of bacterial physiology by lysine acetylation of proteins. New biotechnol. 31 (6), 586-595 (2014).
  27. Hentchel, K. L., Escalante-Semerena, J. C. Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress. Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).
  28. Ouidir, T., Kentache, T., Hardouin, J. Protein lysine acetylation in bacteria: Current state of the art. Proteomics. 16 (2), 301-309 (2016).
  29. Wolfe, A. J. Bacterial protein acetylation: new discoveries unanswered questions. Curr Genet. 62 (2), 335-341 (2016).
  30. Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. Autoacetylation of the histone acetyltransferase Rtt109. J Biol Chem. 286 (28), 24694-24701 (2011).
  31. Neumann, H., Peak-Chew, S. Y., Chin, J. W. Genetically encoding Nε-acetyllysine in recombinant proteins. Nat chem biol. 4 (4), 232-234 (2008).
  32. Fan, C., Xiong, H., Reynolds, N. M., Soll, D. Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids. Nucleic Acids Res. 43 (22), e156 (2015).
  33. Bryson, D., et al. Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity. Nat Chem Biol. , (2017).
  34. Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. Studying the Lysine Acetylation of Malate Dehydrogenase. J Mol Biol. 429 (9), 1396-1405 (2017).
  35. Venkat, S., Gregory, C., Gan, Q., Fan, C. Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli. Chembiochem. 18 (19), 1928-1934 (2017).
  36. Liu, C. C., Schultz, P. G. Adding new chemistries to the genetic code. Annu Rev Biochem. 79, 413-444 (2010).
  37. Mukai, T., Lajoie, M. J., Englert, M., Soll, D. Rewriting the Genetic Code. Annu Rev Microbiol. , (2017).
  38. O’Donoghue, P., Ling, J., Wang, Y. S., Soll, D. Upgrading protein synthesis for synthetic biology. Nat Chem Biol. 9 (10), 594-598 (2013).
  39. Chin, J. W. Expanding and reprogramming the genetic code of cells and animals. Annu Rev Biochem. 83, 379-408 (2014).
  40. O’Donoghue, P., et al. Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion. FEBS Lett. 586 (21), 3931-3937 (2012).
  41. Aerni, H. R., Shifman, M. A., Rogulina, S., O’Donoghue, P., Rinehart, J. Revealing the amino acid composition of proteins within an expanded genetic code. Nucleic Acids Res. 43 (2), e8 (2015).
  42. Huang, Y., et al. A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli. Mol Biosyst. 6 (4), 683-686 (2010).
  43. Venkat, S., et al. Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli. FEBS Open. , (2017).
  44. Wan, W., Tharp, J. M., Liu, W. R. Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool. Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).
  45. Gregoretti, I. V., Lee, Y. M., Goodson, H. V. Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis. J Mol Biol. 338 (1), 17-31 (2004).
  46. Weinert, B. T., et al. Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli. Mol cell. 51 (2), 265-272 (2013).

Tags

Site-specific AcetylationProtein AcetylationGenetic Code ExpansionPyrrolysyl-tRNA SynthetaseAmber Stop CodonE. Coli ExpressionSite-directed MutagenesisAcetyllysine Incorporation
check_url/57061?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Venkat, S., Gregory, C., Meng, K., Gan, Q., Fan, C. A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli. J. Vis. Exp. (130), e57061, doi:10.3791/57061 (2017).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image