CRISPR/Cas9 sistemi kullanılarak Trypanosoma cruzi 'Nin Amastigote aşamasına doğrudan bir gene Knockout tanıtımı
Summary
Burada, CRISPR/Cas9 sistemini kullanarak , Trypanosoma cruzi ‘nin ekstrellüler amastigote içine bir gen nakavt tanıtmak için bir protokol açıklanmaktadır. Büyüme fenotipi ya akenik amastigote kültürün hücre sayımı ya da ana hücre istilasından sonra hücreli formları proliferasyonu ile takip edilebilir.
Abstract
Tripanosoma cruzi bir patojenik protozoon paraziti neden Chagas ‘ hastalık Latin Amerika ağırlıklı olarak. T. cruzikarşı yeni bir ilaç hedefi tanımlamak için, parazitin memelinin aşamasında hedef geni esaslığını doğrulamak için önemlidir, amastigote. T. cruzi ‘nin amastigotları ana hücre içinde çoğaltır; Böylece, diğer gelişimsel aşamalarında gitmeden bir nakavt deney yapmak zordur. Son zamanlarda grubumuz, amastigote ‘nin amastigote benzeri özelliklerini kaybetmeden 10 güne kadar axenically çoğaltılacağı bir büyüme durumu bildirdi. Bu temporal akenik amastigote kültürünü kullanarak, gRNAs ‘ı doğrudan Cas9-ifade amastigote ‘ye, gen taklalarına neden olan ve fenotiplerini sadece amastigote aşamasında analiz etmeye başarıyla tanıttık. Bu raporda, in vitro türev ekstrasellüler amastigotes üretmek için ayrıntılı bir protokol tarif ve bir CRISPR/Cas9-aracılı nakavt deneyi akenik kültürü kullanmak. Nakavt amastigotlerin büyüme fenotipi, ya axenik kültürün hücre sayısıyla ya da ana hücre istilasından sonra hücreler arası amastigote çoğaltılması ile değerlendirilebilir. Bu yöntem, normalde bir transgenik veya nakavt amastigote üreten dahil parazit sahne farklılaşma atlar. Temporal akenik amastigote kültürünün kullanılması, T. cruzi ‘de sahne özel çalışmaların deneysel özgürlüğünü genişletme potansiyeline sahiptir.
Introduction
Tripanosoma cruzi Chagas ‘ hastalığın nedensel Ajan, hangi Latin Amerika ağırlıklı olarak yaygındır1. T. cruzi bir böcek vektör ve bir memeli ev sahibi2arasında seyahat gibi ayırt edici yaşam döngüsü aşamaları vardır. T. cruzi bir kan-emme triatomin böcek midgut bir epimastigote olarak çoğaltır ve bir insan veya hayvan ev sahibi üzerine yatırılan önce onun hindgut bir bulaşıcı metacyclic tripomastigote ayırt. Tripomastigote, ısırık sitesi veya Mukoza zarı yoluyla ana gövdeye girdikten sonra, parazit bir ev sahibi hücresini işgal ediyor ve bir amastigote denilen flagella-Less yuvarlak bir forma dönüşür. Amastigote ana hücre içinde çoğaltır ve sonunda ana hücre dışarı patlamaları ve başka bir ana hücre bulaştırmak için kan akışını girer tripomastigote, ayırır.
Şu anda mevcut kemoterapötik ajanlar, benznidazol ve nifurtimox, olumsuz yan etkilere neden ve hastalığın kronik aşamasında etkisiz3, T. cruzi karşı yeni uyuşturucu hedefleri belirlemek için büyük bir ilgi olduğunu. Son yıllarda, CRISPR/Cas9 sistemi etkili bir şekilde T. cruzigen nakavt gerçekleştirmek için güçlü bir araç haline gelmiştir, ya ayrı veya tek plazmid nakli tarafından (s) Grna ve Cas94içeren, istikrarlı ifade tarafından Cas9 ve sonraki Grna5,6,7 veya transkripsiyon şablonuna giriş8, ya da önceden biçimlendirilmiş Grna/Cas9 RNP kompleksi7,9Elektroporasyon. Bu teknolojik gelişme Chagas hastalığında ilaç hedef araştırma hızlandırmak için son derece beklenen.
İlaç gelişimi ile devam etmek için, bu meme ev sahibi parazitin çoğaltma aşaması olduğu gibi, T. cruziamastigote içinde uyuşturucu aday bileşiklerin hedef geni veya etkinliğini geçerliliğini doğrulamak için çok önemlidir. Ancak, bu zorlu bir görevdir, çünkü formları bir obstrüktif konak hücresinin varlığı nedeniyle doğrudan manipüle edilemez. Leishmania‘da, T. cruzi‘ye yakından ilgili protozoon paraziti, aksiyenik amastigote kültür yöntemi geliştirilmiştir ve ilaç taramasında10,11,12, 13. axenik formları ve hücre içi formları14arasındaki bileşiklere duyarsızlık bazı uyuşmazlıklar olmasına rağmen, axenik kültürü korumak için yeteneği yine de çalışma için değerli deneysel araçlar sağlar Leishmania‘nın klinik olarak alakalı aşamasının temel biyolojisi15,16. T. cruzidurumunda, doğal olarak ortaya çıkan ekstrasellüler formları (EA)17 ve in vitro üretim EA17,18,19 varlığı ile ilgili literatür geri onlarca yıl önce. Buna ek olarak, EA, tripomastigote daha az olsa da, bulaşıcı bir yetenek20olduğu bilinmektedir ve amastigote ev sahibi istilası mekanizması son yıllarda (Bonfim-Melo ve al.21tarafından gözden geçirilmiş) aydınlatılamamıştır olmuştur. Ancak, Leishmaniaaksine, EA T. cruzideneysel bir araç olarak kullanılmadı, öncelikle çünkü EA bir zorunlu hücre içi paraziti olarak kabul edilmişti, ve bu nedenle pratik olarak “çoğaltıcı formu” olarak kabul edilmedi Anlamda.
Son zamanlarda, grubumuz bir temporal akenik kültür olarak T. cruzi EA kullanmak için önerilen22. T. cruzi tulahuen strain ‘in amastigotları 37 °c ‘ de ışık ortamında ana hücrelerden ücretsiz olarak, büyük bozulma veya amastigote benzeri özelliklerin kaybı olmaksızın 10 güne kadar çoğalabilir. Ev sahibi-serbest büyüme döneminde, EA başarıyla geleneksel Elektroporasyon tarafından eksojen gen ifadesi için kullanılmıştır, tripanokidal bileşikler ile ilaç titrasyon tahlil, ve CRISPR/Cas9-aracılı nakavt büyüme fenotip izleme izledi. Bu raporda, In vitro türevi EA üretmek ve nakavt deneylerinde aksiyenik amastigote kullanmak için ayrıntılı protokol açıklanmaktadır.
Protocol
Representative Results
Discussion
Biz T. cruzi formları, axenik kültürün Crispr/Cas9-aracılı gen nakavt, doğrudan Cas9-ifade EA içine Grna electroporating tarafından kullanılabilecek göstermiştir. Bu şekilde, özellikle amastigote aşamasında hedef genin esaslığı diğer Gelişimsel aşamalara girmeden değerlendirilebilir.
Amastigote transfeksiyonunun başka bir faydalı yönü, çok sayıda hedef genler için test kolaylığı. Bir kez Co-Culture Cas9-ifade T. cruzi ve ev sahibi memeli hücr…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Bu çalışma, kısmen JSPS KAKENHı Grant numarası 18K15141 için YT için desteklenmektedir
Materials
| 20% formalin solution | FUJIFILM Wako Pure Chemical | 068-03863 | fixing cells |
| 25 cm2 double seal cap culture flask | AGC Techno Glass | 3100-025 | |
| 75 cm2 double seal cap culture flask | AGC Techno Glass | 3110-075 | |
| All-in One Fluorescence Microscope | Keyence | BZ-X710 | |
| Alt-R CRISPR-Cas9 crRNA (for Control) | IDT | custom made | target sequence = GGACGGCACCTTCATCTACAAGG |
| Alt-R CRISPR-Cas9 crRNA (for TcCGM1) | IDT | custom made | target sequence = TAGCCGCGATGGAGAGTTTATGG |
| Alt-R CRISPR-Cas9 crRNA (for TcPAR1) | IDT | custom made | target sequence = CGTGGAGAACGCCATTGCCACGG |
| Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072532 | to anneal with crRNA |
| Amaxa Nucleofector device | LONZA | AAN-1001 | electroporation |
| Basic Parasite Nucleofector Kit 2 | LONZA | VMI-1021 | electroporation |
| BSA | Sigma-Aldrich | A3294 | component of the medium for in-vitro amastigogenesis |
| Burker-Turk disposable hemocytometer | Watson | 177-212C | cell counting |
| Coster 12-well Clear TC-Treated Multiple Well Plates | Corning | 3513 | |
| DMEM | FUJIFILM Wako Pure Chemical | 044-29765 | culture medium |
| Fetal bovine serum, Defined | Hyclone | SH30070.03 | heat-inactivate before use |
| G-418 Sulfate Solution | FUJIFILM Wako Pure Chemical | 077-06433 | selection of transformant |
| Hemin chloride | Sigma-Aldrich | H-5533 | component of LIT medium |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | staining of nuclei |
| Liver infusion broth, Difco | Becton Dickinson | 226920 | component of LIT medium |
| MES | FUJIFILM Wako Pure Chemical | 349-01623 | component of the medium for in-vitro amastigogenesis |
| PBS (–) | FUJIFILM Wako Pure Chemical | 166-23555 | |
| Propidium Iodide | Sigma-Aldrich | P4864-10ML | staining of dead cells |
| RPMI 1646 | Sigma-Aldrich | R8758 | medium for metacyclogenesis |
References
- World Health Organization. . (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).
- Clayton, J. Chagas disease 101. Nature. 465 (n7301_supp), S4-S5 (2010).
- Apt, W. Current and developing therapeutic agents in the treatment of Chagas disease. Drug Design, Development and Therapy. 4, 243-253 (2010).
- Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment. mBio. 6 (4), e01012 (2015).
- Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. mBio. 6 (1), e02097-e02114 (2015).
- Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi. Acta Tropica. 178, 190-195 (2018).
- Burle-Caldas, G. A., Soares-Simões, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants. International Journal for Parasitology. 48 (8), 591-596 (2018).
- Costa, F. C. Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping. PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).
- Soares Medeiros, L. C. High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. mBio. 8 (6), (2017).
- Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. An axenic amastigote system for drug screening. Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).
- Bates, P. A. Axenic culture of Leishmania amastigotes. Parasitology Today. 9 (4), 143-146 (1993).
- Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds. Current Microbiology. 65 (6), 696-700 (2012).
- Nühs, A. Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity. PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).
- De Rycker, M. Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay. Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).
- Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum. Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).
- Pescher, P., Blisnick, T., Bastin, P., Späth, G. F. Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular Microbiology. 13 (7), 978-991 (2011).
- Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi. Experimental Parasitology. 64 (3), 474-484 (1987).
- Pan, S. C. Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C. Experimental Parasitology. 45 (2), 215-224 (1978).
- Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH. Parasitology. 110 (05), 547 (1995).
- Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells. Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).
- Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes. Frontiers in Microbiology. 9, 1341 (2018).
- Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi. PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).
- Fernandes, J. F., Castellani, O. Growth characteristics and chemical composition of Trypanosoma cruzi. Experimental Parasitology. 18 (2), 195-202 (1966).
- Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes. Methods in Cell Biology. 93, 21-57 (2009).
- van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Research. 20 (11), 2902-2902 (1992).
- Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection. Parasitology International. 66 (3), 236-239 (2017).
- Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3’-untranslated region position-dependent cis-element and an untranslated region-binding protein. The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).
- Shaw, A. K., Kalem, M. C., Zimmer, S. L. Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi. mSphere. 1 (2), (2016).
- Chao, D., Dusanic, D. G. Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography. Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).
- Nogueira, N., Bianco, C., Cohn, Z. Studies on the selective lysis and purification of Trypanosoma cruzi. The Journal of Experimental Medicine. 142 (1), 224-229 (1975).
- Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi. BMC Genomics. 10, 370 (2009).
- Rico, E., Jeacock, L., Kovářová, J., Horn, D. Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Scientific Reports. 8 (1), 7960 (2018).
- Fu, Y. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. 31 (9), 822-826 (2013).
- Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24 (6), 1012-1019 (2014).
- Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi. mBio. 8 (3), e00574-e00617 (2017).
