Mikroinjektion von rekombinantem RCAS(A)-Retrovirus in embryonale Hühnerlinse
Summary
Dieses Protokollpapier beschreibt die Methodik der Mikroinjektion eines RCAS(A)-Retrovirus in embryonale Hühnerlinsen als Werkzeug zur Untersuchung der In-situ-Funktion und Expression von Proteinen während der Linsenentwicklung.
Abstract
Das embryonale Huhn (Gallus domesticus) ist aufgrund seiner hohen Ähnlichkeit mit der menschlichen Linse ein etabliertes Tiermodell für die Untersuchung der Linsenentwicklung und -physiologie. RCAS(A) ist ein replikationskompetentes Hühner-Retrovirus, das sich teilende Zellen infiziert und als leistungsfähiges Werkzeug dient, um die In-situ-Expression und -Funktion von Wildtyp- und Mutantenproteinen während der Linsenentwicklung durch Mikroinjektion in das leere Lumen des Linsenvesikels in frühen Entwicklungsstadien zu untersuchen und seine Wirkung auf die umgebenden proliferierenden Linsenzellen zu beschränken. Im Vergleich zu anderen Ansätzen, wie z.B. transgenen Modellen und ex vivo Kulturen, bietet die Verwendung eines RCAS(A)-replikationskompetenten aviären Retrovirus ein hocheffektives, schnelles und anpassbares System zur Expression exogener Proteine in Kükenembryonen. Insbesondere kann der gezielte Gentransfer auf proliferative Linsenfaserzellen beschränkt werden, ohne dass gewebespezifische Promotoren erforderlich sind. In diesem Artikel geben wir einen kurzen Überblick über die Schritte, die für die Herstellung des rekombinanten Retrovirus RCAS(A) erforderlich sind, geben einen detaillierten, umfassenden Überblick über das Mikroinjektionsverfahren und stellen Beispielergebnisse der Technik zur Verfügung.
Introduction
Das Ziel dieses Protokolls ist es, die Methodik der Mikroinjektion eines RCAS(A) (replikationskompetentes aviäres Sarkom/Leukose-Retrovirus A) in embryonale Hühnerlinsen zu beschreiben. Die effektive retrovirale Verabreichung in eine embryonale Hühnerlinse hat sich als vielversprechendes Werkzeug für die In-vivo-Untersuchung des molekularen Mechanismus und der Strukturfunktion von Linsenproteinen in normaler Linsenphysiologie, pathologischen Bedingungen und Entwicklung erwiesen. Darüber hinaus könnte dieses experimentelle Modell für die Identifizierung therapeutischer Ziele und das Screening von Medikamenten für Erkrankungen wie den menschlichen kongenitalen Katarakt verwendet werden. Insgesamt zielt dieses Protokoll darauf ab, die notwendigen Schritte für die Entwicklung einer anpassbaren Plattform für die Untersuchung von Linsenproteinen festzulegen.
Embryonale Küken (Gallus domesticus) sind aufgrund ihrer Ähnlichkeit in Linsenstruktur und -funktion mit der menschlichen Linse ein etabliertes Tiermodell für die Untersuchung der Linsenentwicklung und -physiologie 1,2,3,4. Die Verwendung eines RCAS(A)-replikationskompetenten aviären Retrovirus gilt als hocheffektives, schnelles und anpassbares System zur Expression exogener Proteine in Kükenembryonen. Insbesondere hat es eine einzigartige Fähigkeit, den Zielgentransfer auf proliferative Linsenfaserzellen zu beschränken, ohne dass gewebespezifische Promotoren erforderlich sind, wobei der einzigartige embryonale Entwicklungszeitrahmen verwendet wird, in dem das Vorhandensein von leerem Linsenlumen eine In-situ-RCAS(A)-Mikroinjektion in die eingeschränkte Stelle für die Expression exogener Proteine in proliferativen Linsenfaserzellen ermöglicht5, 6,7,8.
Das hier ausführlich beschriebene Verfahren der Mikroinjektion von Kükenembryonen basiert ursprünglich teilweise auf den Arbeiten von Fekete et. al.6 und weiterentwickelt von Jiang et. al.8 und wurde als Mittel verwendet, um sowohl virale als auch nichtvirale Plasmide in die Linse embryonaler Küken einzuführen 1,9,10,11,12,13. Insgesamt zeigt die bisherige Arbeit das Potenzial der Verwendung dieser Methodik zur Untersuchung der Linsenentwicklung, -differenzierung, zellulären Kommunikation und des Fortschreitens von Krankheiten sowie zur Entdeckung und Erprobung therapeutischer Ziele für Linsenerkrankungen wie Katarakte.
Protocol
Representative Results
Discussion
Dieses experimentelle Modell bietet die Möglichkeit, das/die interessierende(n) Protein(e) in der intakten Linse zu exprimieren, was zur Untersuchung der funktionellen Relevanz dieser Proteine für die Struktur und Funktion der Linse führt. Das Modell der Mikroinjektion von embryonalen Küken basiert teilweise auf den Arbeiten von Fekete et. al.6 und wurde von Jiang et. al.8 und wurde als Mittel zum Einfügen von viralen Plasmiden und Wirkstoffen wie Agonisten, kleiner in…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Diese Arbeit wurde durch die National Institutes of Health (NIH) Grants: RO1 EY012085 (an J.X.J) und F32DK134051 (an F.M.A.) und die Welch Foundation Grants: AQ-1507 (an J.X.J.) unterstützt. Der Inhalt liegt in der alleinigen Verantwortung der Autoren und stellt nicht unbedingt die offizielle Meinung der National Institutes of Health dar. Die Figuren wurden teilweise mit Biorender.com erstellt.
Materials
| 0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
| 35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
| Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
| Constructs | GENEWIZ | – | For generation of constructs |
| Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
| DNA PCR primers | Integrated DNA Technologies | – | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
| Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
| Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
| Egg Holder | – | – | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
| Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
| Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
| Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
| Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
| Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
| Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
| Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
| Lipofectamine | Invitrogen | L3000001 | For transfection |
| Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
| Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
| Microscope | Keyence | BZ-X710 | For imaging staining |
| Parafilm | FisherScientific | 03-448-254 | Placing solution |
| Penicillin/Streptomycin | Invitrogen | For cell culture | |
| Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
| rabbit anti-chick AQP0 | Self generated | – | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
| rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
| Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
| Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
References
- Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. Development of a potent embryonic chick lens model for studying congenital cataracts in vivo. Communications Biology. 4 (1), 325 (2021).
- Chen, Y., et al. γ-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds. The FEBS Journal. 283 (8), 1516-1530 (2016).
- Coulombre, A. J., Coulombre, J. L. Lens development. I. Role of the lens in eye growth. Journal of Experimental Zoology. 156 (1), 39-47 (1964).
- McKeehan, M. S. Induction of portions of the chick lens without contact with the optic cup. The Anatomical Record. 132 (3), 297-305 (1958).
- Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo. Molecular immunology. 47 (7-8), 1619-1628 (2010).
- Fekete, D. M., Cepko, C. L. Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo. Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).
- Jiang, J. X. Use of retroviruses to express connexins. Methods in Molecular Biology. , 159-174 (2001).
- Jiang, J. X., Goodenough, D. A. Retroviral expression of connexins in embryonic chick lens. Investigative Ophthalmology & Visual Science. 39 (3), 537-543 (1998).
- Shestopalov, V. I., Bassnett, S. Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core. Journal of Cell Science. 113 (11), 1913-1921 (2000).
- Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50. Journal of Cell Science. 124 (2), 198-206 (2011).
- Li, Z., et al. The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression. Journal of Biological Chemistry. 299 (3), 102965 (2023).
- Shestopalov, V. I., Bassnett, S. Exogenous gene expression and protein targeting in lens fiber cells. Investigative Ophthalmology & Visual Science. 40 (7), 1435-1443 (1999).
- Shestopalov, V. I., Bassnett, S. Three-dimensional organization of primary lens fiber cells. Investigative Ophthalmology & Visual Science. 41 (3), 859-863 (2000).
- Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. Journal of Virology. 61 (10), 3004-3012 (1987).
- Yan, R. T., Wang, S. Z. Production of high-titer RCAS retrovirus. Methods in Molecular Biology. 884, 193-199 (2012).
- Kingston, R. E. Introduction of DNA into mammalian cells. Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).
- Li, Y., et al. Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model. STAR Protocols. 3 (1), 101060 (2022).
- Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Developmental Dynamics. 195 (4), 231-272 (1992).
- Hallagan, J. B., Allen, D. C., Borzelleca, J. F. The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification. Food and Chemical Toxicology. 33 (6), 515-528 (1995).
- Okada, T. S., Eguchi, G., Takeichi, M. The expression of differentiation by chicken lens epithelium in in vitro cell culture. Development, Growth & Differentiation. 13 (4), 323-336 (1971).
- Menko, A. S., Klukas, K. A., Johnson, R. G. Chicken embryo lens cultures mimic differentiation in the lens. Developmental Biology. 103 (1), 129-141 (1984).
- Parreno, J., et al. Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells. Frontiers in Cell and Developmental Biology. 10, 983178 (2022).
- Edwards, A., Gupta, J. D., Harley, J. D. Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens. Experimental Eye Research. 15 (4), 495-498 (1973).
- Musil, L. S. Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation. Journal of Membrane Biology. 245 (7), 357-368 (2012).
- West-Mays, J. A., Pino, G., Lovicu, F. J. Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis. Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).
- Upreti, A., et al. Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response. Cells. 12 (3), 501 (2023).
- Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. Activation of SRC kinases signals induction of posterior capsule opacification. Investigative Ophthalmology & Visual Science. 48 (5), 2214-2223 (2007).
- Briskin, M. J., et al. Heritable retroviral transgenes are highly expressed in chickens. Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).
- Hughes, S. H. The RCAS vector system. Folia Biologica. 50 (3-4), 107-119 (2004).
