1. Design the FRET assay.

1. Download the structure file of the Cul1•Cand1 complex from the Protein Data Bank (file 1U6G).
2. View the structure of the Cul1•Cand1 complex in PyMOL.
3. Use the Measurement function under the Wizard menu of PyMOL to estimate the distance between the first amino acid of Cand1 and the last amino acid of Cul1 (Figure 1).
4. Load the online spectra viewer (see Table of Materials) and view the excitation and emission spectra of 7-amino-4-methylcoumarin (AMC) and FlAsH simultaneously (Figure 2). Note that AMC is the FRET donor and FlAsH is the FRET acceptor.

Figure 1: The crystal structure of Cul1•Cand1 and measurement of the distance between potential labeling sites. The crystal structure file was downloaded from Protein Data Bank (File 1U6G), and viewed in PyMOL. Measurements between selected atoms were done by PyMOL. Please click here to view a larger version of this figure.

Figure 2: The excitation and emission spectra of the fluorescent dyes for FRET. Spectra of AMC (7-amino-4-methylcoumarin) and FlAsH are shown. Dashed lines indicate excitation spectra, and solid lines indicate emission spectra. The image was originally generated by the Fluorescence SpectraViewer and was modified for better clarity. Please click here to view a larger version of this figure.

2. Preparation of Cul1^AMC•Rbx1, the FRET donor protein

1. Construct plasmids for expressing human Cul1^sortase•Rbx1 in E. coli cells. Note that the two plasmids co-expressing human Cul1•Rbx1 in E. coli cells are described in detail in a previous report²⁰.
   1. Add a DNA sequence coding “LPETGGHHHHHH” (sortase-His₆ tag) to the 3’ end of Cul1 coding sequence through standard PCR and cloning methods^21,22.
   2. Sequence the new plasmid to confirm the gene insert is accurate.
2. Co-express Cul1^sortase•Rbx1 in E. coli cells. The method is derived from a previous report²⁰.
   1. Mix 100 ng each of the two plasmids with BL21 (DE3) chemically competent cells for co-transformation using the heat shock method²³. Grow cells on LB agar plate containing 100 µg/mL ampicillin and 34 µg/mL chloramphenicol at 37 °C overnight.
   2. Inoculate 50 mL of LB culture with freshly transformed colonies and grow overnight at 37 °C with 250 rpm shaking. This gives a starter culture.
   3. Inoculate 6 flasks, each with 1 L of LB medium, with 5 mL starter culture each and grow at 37 °C with 250 rpm shaking until the OD₆₀₀ is ~1.0. Cool the culture to 16 °C and add isopropyl-β-D-thiogalactoside (IPTG) to 0.4 mM. Keep the culture at 16 °C overnight with 250 rpm shaking.
   4. Harvest the E. coli cells through centrifugation at 5,000 x g for 15 min and collect cell pellets in 50 mL conical tubes.
      NOTE: The cell pellets can be processed for protein purification or be frozen at -80 °C before proceeding to the protein purification steps.
3. Purification of the Cul1^sortase•Rbx1 complex. This method is derived from a previous report²⁰.
   1. Add 50 mL of lysis buffer (30 mM Tris-HCl, 200 mM NaCl, 5 mM DTT, 10% glycerol, 1 tablet of protease inhibitor cocktail, pH 7.6) to the pellet of E. coli cells expressing Cul1^sortase•Rbx1.
   2. Lyse the cells on ice with sonication at 50% amplitude. Alternate between 1-second ON and 1-second OFF and run for 3 min.
   3. Repeat step 2.3.2 2-3x.
   4. Transfer the cell lysate into a 50-mL centrifugation tube and remove the cell debris by centrifugation at 25,000 x g for 45 min.
   5. Incubate the clear cell lysate with 5 mL of glutathione beads at 4 °C for 2 h.
   6. Centrifuge the beads-lysate mixture at 1,500 x g for 2 min at 4 °C. Remove the supernatant.
   7. Wash the beads with 5 mL of lysis buffer (with no protease inhibitors) and remove the supernatant after centrifugation at 1,500 x g for 2 min at 4 °C.
   8. Repeat step 2.3.7 2x.
   9. Add 3 mL of lysis buffer to the washed beads and transfer the bead slurry into an empty column.
   10. Add 5 mL of elution buffer (50 mM Tris-HCl, 200 mM NaCl, 10 mM reduced glutathione, pH 8.0) into the column. Incubate for 10 min and collect the eluate.
   11. Repeat step 2.3.10 3-4x.
   12. Add 200 µL of 5 mg/mL thrombin (see Table of Materials) to the eluate from the glutathione beads and incubate overnight at 4 °C.
       NOTE: The protocol can be paused here.
   13. Dilute the protein sample with Buffer A (25 mM HEPES, 1 mM DTT, 5% glycerol, pH 6.5) threefold.
   14. Equilibrate a cation exchange chromatography column (see Table of Materials) on an FPLC system with Buffer A.
   15. Load the protein sample to the equilibrated cation exchange chromatography column at a 0.5 mL/min flow rate.
   16. Elute the protein with a gradient of NaCl in 40 mL by mixing Buffer A and 0 to 50% Buffer B (25 mM HEPES, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 6.5) at a 1 mL/min flow rate.
   17. Check the eluted protein in different fractions using SDS-PAGE²⁴.
       NOTE: The protocol can be paused here.
   18. Pool the eluate fractions containing Cul1^sortase•Rbx1.
   19. Concentrate the pooled Cul1^sortase•Rbx1 sample to 2.5 mL by passing the buffer through an ultrafiltration membrane (30 kDa cutoff).
4. Add AMC to the C-terminus of Cul1 through sortase-mediated transpeptidation^21,22.
   1. Change the buffer in the Cul1^sortase•Rbx1 sample to the sortase buffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl₂, pH 7.5) using a desalting column (see Table of Materials).
      1. Equilibrate a desalting column with 25 mL of sortase buffer.
      2. Load 2.5 mL of Cul1^sortase•Rbx1 sample into the column. Discard the flow-through.
      3. Elute the sample with 3.5 mL of sortase buffer. Collect the flow-through.
   2. In 900 µL of the Cul1^sortase•Rbx1 solution in the sortase buffer, add 100 µL of 600 µM purified sortase A solution and 10 µL of 25 mM GGGG^AMC peptide. Incubate the reaction mixture at 30 °C in the dark overnight. Note that this step will generate Cul1^AMC•Rbx1.
      CAUTION: Fluorescent dyes are sensitive to light, so avoid exposing them to ambient light during the protein and sample preparation as much as possible.
      NOTE: The protocol can be paused here.
   3. Add 50 µL of Ni-NTA agarose beads to the reaction mixture and incubate at room temperature for 30 min.
   4. Pellet the Ni-NTA agarose beads by centrifugation at 5,000 x g for 2 min and collect the supernatant.
   5. Equilibrate a size exclusion chromatography column (see Table of Materials) with buffer (30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol) on the FPLC system.
   6. Load all the Cul1^AMC•Rbx1 sample on the size exclusion chromatography column. Elute with 1.5x column volume of buffer.
   7. Check the eluate fractions by SDS-PAGE²⁴.
   8. Pool the eluate fractions containing Cul1^AMC•Rbx1.
   9. Measure the protein concentration using its absorbance at 280 nm with a spectrophotometer.
   10. Aliquot the protein solution and store at -80 °C.
       NOTE: The protocol can be paused here.

3. Preparation of ^FlAsHCand1, the FRET acceptor protein

NOTE: Most of steps in this part are the same as Step 2. Conditions that differ are described in detail below.

1. Construct the plasmid for expressing human ^TetraCysCand1 in E. coli cells.
   1. Add DNA sequence coding “CCPGCCGSG” (tetracysteine/TetraCys tag) before the 15^th amino acid of Cand1 through regular PCR²⁵ (primer sequences: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
   2. Insert the PCR product into a pGEX-4T-2 vector. Sequence the plasmid to confirm the gene insert is accurate and in frame.
2. Express ^TetraCysCand1in E. coli cells in the same way as step 2.2, except that the plasmid is transformed into Rosetta competent cells.
3. Purification of ^TetraCysCand1 from the E. coli cells.
   1. Lyse the E. coli cell pellets and extract ^TetraCysCand1using glutathione beads. These steps are the same as steps 2.3.1–2.3.12.
   2. Dilute the protein eluate from the glutathione beads with Buffer C (50 mM Tris-HCl, 1 mM DTT, 5% glycerol, pH 7.5) by three folds. Equilibrate an anion exchange chromatography column (see Table of Materials) on the FPLC system with Buffer C and load the diluted protein sample at a 0.5 mL/min flow rate.
   3. Elute the protein with a gradient of NaCl in 40 mL by mixing Buffer C and 0 to 50% Buffer D (50 mM Tris-HCl, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 7.5) at a 1 mL/min flow rate. Check the eluted protein in different fractions using SDS-PAGE²⁴, and pool the fractions containing ^TetraCysCand1. Note that ^TetraCysCand1 has a larger retention volume than free GST.
   4. Concentrate the pooled ^TetraCysCand1 sample by passing the buffer through an ultrafiltration membrane (30 kDa cutoff).
   5. Equilibrate the size exclusion chromatography column with labeling buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM TCEP, 1 mM EDTA, 5% glycerol) on the FPLC system. Load ^TetraCysCand1 sample (500 µL each time) and check the eluate fractions by SDS-PAGE²⁴.
   6. Pool all the fractions containing ^TetraCysCand1 and concentrate the protein to ~40 µM by passing the buffer through an ultrafiltration membrane (30 kDa cutoff). Estimate the protein concentration using its absorbance at 280 nm. Store the protein as 50 µL aliquots at -80 °C.
      NOTE: The protocol can be paused here.
4. Preparation of ^FlAsHCand1.
   1. Add 1 µL of FlAsH solution (see Table of Materials) to 50 µL ^TetraCysCand1 solution.
   2. Mix well and incubate the mixture at room temperature in the dark for 1-2 h to get ^FlAsHCand1.
      NOTE: The protocol can be paused here.

4. Preparation of Cand1, the FRET chase protein

NOTE: The protein preparation protocol is similar to Step 3, with the following modifications.

1. Insert the coding sequence of full-length Cand1 into the pGEX-4T-2 vector.
2. Change the buffer used in step 3.3.5 to a buffer containing 30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol.
3. Eliminate steps 3.3.7 and 3.3.8.

5. Test and confirm the FRET assay

1. Prepare the FRET buffer containing 30 mM Tris-HCl, 100 mM NaCl, 0.5 mM DTT, 1 mg/mL ovalbumin, pH 7.6, and use at room temperature.
2. Test the FRET between Cul1^AMC•Rbx1 and ^FlAsHCand1 on a fluorimeter.
   1. In 300 µL of FRET buffer, add Cul1^AMC•Rbx1 (FRET donor) to a final concentration of 70 nM. Transfer the solution into a cuvette.
   2. Place the cuvette in the sample holder of a fluorimeter. Excite the sample with 350 nm excitation light and scan the emission signals from 400 nm to 600 nm at 1 nm increments.
   3. Repeat step 5.2.1 but change Cul1^AMC•Rbx1 to ^FlAsHCand1 (FRET acceptor). Scan the ^FlAsHCand1 sample using the same method as in step 5.2.2.
   4. (Optional) Excite the ^FlAsHCand1 with 510 nm excitation light, and scan the emission signal from 500 nm to 650 nm.
   5. In 300 µL FRET buffer, add both Cul1^AMC•Rbx1 and ^FlAsHCand1 to a final concentration of 70 nM. Analyze the sample in the same way as in step 5.2.2.
3. Confirm the FRET between Cul1^AMC•Rbx1 and ^FlAsHCand1 by adding the chase (unlabeled Cand1) protein (Figure 3C).
   1. In 300 µL of FRET buffer, add 70 nM Cul1^AMC•Rbx1 and 700 nM Cand1. Scan the sample emission as in step 5.2.2.
   2. In 300 µL of FRET buffer, add 70 nM ^FlAsHCand1 and 700 nM Cand1. Scan the sample emission as in step 5.2.2.
   3. In 300 µL of FRET buffer, add 70 nM Cul1^AMC•Rbx1 and 70 nM ^FlAsHCand1, and incubate the sample at room temperature for 5 min. Then add 700 nM Cand1, and immediately after the addition, scan the sample emission as in step 5.2.2). Note that this step is similar to step 5.2.5.
   4. In 300 µL FRET buffer, sequentially add 70 nM Cul1^AMC•Rbx1, 700 nM Cand1, and 70 nM ^FlAsHCand1. Incubate the sample at room temperature for 5 min, and scan the sample emission as in step 5.2.2. Note that this is the chase sample (green line in Figure 3C).

6. Measure the association rate constant (k_on) of Cul1•Cand1

NOTE: Details of operating a stopped-flow fluorimeter has been described in a previous report²⁶.

1. Prepare the stopped-flow fluorimeter for measurement.
   1. Turn on the stopped-flow fluorimeter according to the manufacturer’s instruction.
   2. Set the excitation light at 350 nm, and use a band-pass filter that allows 450 nm emission light to pass and blocks 500-650 nm emission light.
   3. Keep the sample valves at the FILL position, and connect a 3 mL syringe filled with water. Wash the two sample syringes (A and B) with water by moving the sample syringe drive up and down several times. Discard all the water used in this step.
   4. Keep the sample valves at the FILL position, and connect a 3 mL syringe filled with FRET buffer. Wash the two sample syringes with the FRET buffer by moving the sample syringe drive up and down several time. Discard all the FRET buffer used in this step.
2. Take a control measurement (Figure 4C).
   1. Connect a 3 mL syringe and load Syringe A with 100 nM Cul1^AMC•Rbx1 in the FRET buffer. Turn the sample valve to the DRIVE position.
   2. Connect a 3 mL syringe and load Syringe B with the FRET buffer. Turn the sample valve to the DRIVE position.
   3. Use the Control Panel under Acquire in the software to take five shots (mix equal volume of samples from Syringe A and Syringe B) on the stopped-flow fluorimeter without recording the results.
   4. Open the Control Panel under Acquire in the software, and program to record the emission of Cul1^AMC over 60 s. Then take a single shot.
   5. Repeat step 6.2.4 2x.
   6. Turn the sample valve to the FILL position. Empty Syringe B and wash with the FRET buffer.
3. Measure observed association rate constants (k_obs) of Cul1•Cand1 (Figure 4B).
   1. Keep the sample in Syringe A the same as in step 6.2.1.
   2. Connect a 3 mL syringe and load Syringe B with 100 nM ^FlAsHCand1 in the FRET buffer. Turn the sample valve to the DRIVE position.
   3. Use the Control Panel under Acquire in the software to take five shots without recording the results.
   4. Open the Control Panel under Acquire in the software, and program to record the emission of Cul1^AMC over 60 s. Then take a single shot.
   5. Repeat step 6.3.4 2x.
   6. Empty Syringe B and wash with the FRET buffer.
   7. Repeat steps 6.3.1–6.3.6 several times with increasing concentrations of ^FlAsHCand1 in the FRET buffer.
   8. Fit the change (decrease) in fluorescent signals measured over time from each shot to a single exponential curve. This will give k_obs in each measurement, and the unit is s^-1. Note that the basis of this calculation has been well discussed in a previous report²⁷.
4. Calculate the average and standard deviation of k_obs for each ^FlAsHCand1 concentration used. Plot the average k_obs against Cand1 concentration (Figure 4D), and the slope of the line represents the k_on of Cul1•Cand1, with a unit of M^-1 s^-1.

7. Measure the dissociation rate constant (k_off) of Cul1•Cand1 in the presence of Skp1•F-box protein.

NOTE: This step is similar to Step 6, with the following modifications.

1. In Syringe A, under the FILL position, load a solution of 100 nM Cul1^AMC•Rbx1 and 100 nM ^FlAsHCand1 in the FRET buffer. Turn the sample valve to the “DRIVE” position.
2. In Syringe B, under the FILL position, load a solution of Skp1•Skp2 (prepared following a previous report²⁰). Turn the sample valve to the “DRIVE” position.
3. Open the Control Panel under Acquire in the software, and program to record the emission of Cul1^AMC over 30 s. Then take a single shot. The fluorescent signals increase over time after mixing solutions from Syringe A and Syringe B (Figure 5).