All animal procedures are performed in accordance with Cornell University Institutional Animal Care and Use Committee (IACUC).
1. Preparation
2. Tamoxifen Treatment for Cre-Lox genetic Recombination
3. Chemical Depilation
4. UV-B Irradiation
5. Tissue Processing
Cutaneous melanoma initiation induced by chemical depilation
The procedure of chemical depilation is depicted in Figure 2. When mice are 7-weeks postnatal, their dorsal skin is in telogen. During telogen, hair follicle stem cells and MCSCs are known to be in a quiescent, resting state. The skin should show no significant hair growth after shaving. On the other hand, chemical depilation can induce hair follicle stem cell activation, which in turn shows significant hair growth from the region of interest (Figure 2). Similarly, tumor-prone MCSCs expressing oncogenic mutations also need to be active for accelerated tumor formation. Chemical depilation can significantly induce the activation of both hair follicle stem cell and MCSCs. Melanoma-prone MCSCs in an active state can form tumors, and microscopic melanoma initiation can be observed within 2 weeks after chemical depilation using the lineage tracing allele LSL-tdTomato (Figure 3).
Cutaneous melanoma initiation induced by UV-B irradiation
Similar to chemical depilation, UV-B can induce tumor initiation from quiescent tumor-prone MCSCs (Figure 4). While the murine skin containing tumor-prone MCSCs in a quiescent state shows no significant tumor initiation and lack of significant pigmentation, the dorsal skin exposed to UV-B (twice, 180 mJ/cm2) shows black pigmented early melanocytic tumors which are macroscopically evident (Figure 4A, B). While UV-B can significantly induce macroscopically evident tumor initiation within 2 weeks, the application of sunscreen can protect UV-B-mediated melanoma initiation in the skin, similar to a UV-resistant cloth (Figure 4C, D).
Importantly, UV-B induces the direct translocation of MCSCs from their follicular stem cell niche to the interfollicular epidermis. Furthermore, UV-B can induce MCSC-originating cutaneous melanoma formation throughout the interfollicular epidermis, and the microscopic phenotype can be observed by the lineage tracing marker, tdTomato (Figure 5). As these tumor cells are malignant, they grow rapidly and invasively (Figure 5). Similar to the dorsal skin, UV-B-induced melanoma initiation can be notably observed in other skin areas, such as the ear skin (Figure 6). Compared to the control skin covered by UV-resistant cloth, the ear skin exposed to UV-B demonstrates higher pigmentation due to a higher burden of melanoma initiation (Figure 6).
Figure 1: Skin tissue isolation and cryo-embedding. Following euthanasia, shave the mouse dorsal skin region of interest and embed skin in cryomold containing OCT. The dotted line on the mouse represents the midline. Typically, 3 or 4 pieces of skin can be isolated with line segment 3-4 along the midline; one such piece is indicated by rectangle 1/2/3/4. These skin pieces should be embedded in the OCT as shown in the figure. Please click here to view a larger version of this figure.
Figure 2: Macroscopic phenotypes after chemical depilation. (A) Diagram of chemical depilation. (B) After shaving, the hair cycle was confirmed to be in telogen. (C) Chemical depilation was performed to remove hair shafts from the hair follicles, which can activate both hair follicle and melanocyte stem cells. (D) Around a week later, early hair growth will be easily noticeable. (E) Then, significant hair growth can be observed over time. Please click here to view a larger version of this figure.
Figure 3: Microscopic observation of melanoma initiation controlled by chemical depilation. Chemical depilation can significantly induce the activation of quiescent tumor-prone MCSCs. Then, microscopic tumor initiation demonstrated by the lineage tracing marker tdTomato can be observed within 2 weeks. This figure demonstrates the microscopic phenotype 16 days post 3 days tamoxifen by IP injection followed by chemical depilation using different visualizations of the same field of view. (A) tdTomato+ tumor cells originating from the hair follicle merged with Dapi nuclear counter stain. (B) Hair follicles and interfollicular epidermis are outlined in white. (C) A schematic showing how tdTomato+ tumor cells invade into the dermis from the hair follicle, modified from Moon, H. et al.6. Please click here to view a larger version of this figure.
Figure 4: Macroscopic phenotype of cutaneous melanoma induced by UV-B irradiation. Mice were treated by tamoxifen for 3 days (day 1 to 3) followed by 2 UV-B exposures (day 4 and 6). (A) Diagram of UV-B irradiation on the dorsal skin containing mutant MCSCs. (B) Macroscopic phenotype between control and UV-B exposed dorsal skin. Significant black pigmentation related to melanocytic tumor formation can be observed within 2 weeks after the second UV-B irradiation. (C) Diagram of sunscreen application. (D) While UV-B can significantly induce tumor initiation from mutant MCSCs, application of sunscreen showed significantly suppressed UV-B-mediated tumor initiation (16 days post the second UV-B irradiation). Please click here to view a larger version of this figure.
Figure 5: Microscopic observation of UV-B-induced cutaneous melanoma. Mice were treated with tamoxifen by IP injection for 3 days (day 1 to 3) followed by 2 UV-B exposures (day 4 and 5). (A-C) Early tumor initiation throughout the interfollicular epidermis demonstrated by lineage tracing tdTomato can be shown at day 17. (A) tdTomato+ tumor cells are shown migrating from the hair follicle into the interfollicular epidermis. Dapi is used as a nuclear counter stain. (B) Dapi staining is removed and dotted line indicates location of the hair follicles and interfollicular epidermis. (C) Schematic indicating tdTomato+ cell migration from the hair germ to the interfollicular epidermis following UV-B exposure. Modified from Moon et al.6. (D-F) Then, tumor cells grow rapidly and invade the dermal tissues below (day 25). (D) tdTomato+ tumor cells have continued to proliferate and invade into the dermal tissues. Dapi is used as a nuclear counter stain. (E) Dapi staining is removed and dotted line indicates the location of the hair follicles and interfollicular epidermis. (F) Schematic indicating tdTomato+ cell invasion into the dermis and melanocytic tumor growth. Modified from Moon et al.6. Please click here to view a larger version of this figure.
Figure 6: Macroscopic and microscopic observation of UV-B-induced melanoma in ear skin. (A) Experimental scheme. Mice were treated by tamoxifen for 3 days (day 1 to 3) followed by 3 exposures to UV-B irradiation (day 4, 6 and 8). (B) Significantly increased melanoma initiation by UV-B irradiation was observed macroscopically as well as microscopically at day 28. Please click here to view a larger version of this figure.
Tamoxifen | Sigma | T5648-1G | For systemic injection |
Tamoxifen | Cayman Chemical | 13258 | For systemic injection |
Corn oil | Sigma | 45-C8267-2.5L-EA | |
4OH-tamoxifen | Sigma | H7904-25MG | For topical treatment |
26g 1/2" needles | various | Veterinary grade | |
1 mL syringe | various | Veterinary grade | |
Pet hair trimmer | Wahl | 09990-502 | |
Hair removal cream | Nair | n/a | Available at most drug stores |
Cotton swabs | various | ||
Ultraviolet light bulb | UVP | 95-0042-08 | model XX-15M midrange UV lamp |
200 proof ethanol | various | pure ethanol | |
Histoplast PE | Fisher Scientific | 22900700 | paraffin pellets |
Neutral Buffered Formalin, 10% | Sigma | HT501128-4L | |
Clear-Rite 3 | Thermo Scientific | 6901 | xylene substitute |
O.C.T. Compound | Thermo | 23730571 | |
Tissue Cassette | Sakura | 89199-430 | for FFPE processing |
Cryomolds | Sakura | 4557 | 25 x 20 mm |
FFPE metal mold | Leica | 3803082 | 24 x 24 mm |
Isoflurane | various | Veterinary grade | |
Anesthesia inhalation system | various | Veterinary grade | |
Fine scissor | FST | 14085-09 | Straight, sharp/sharp |
Fine scissor | FST | 14558-09 | Straight, sharp/sharp |
Metzenbaum | FST | 14018-13 | Straight, blunt/blunt |
Forcep | FST | 11252-00 | Dumont #5 |
Forcep | FST | 11018-12 | Micro-Adson |
Tyr-CreER; LSL-BrafV600E; Pten-f/f | Jackson Labs | 13590 | |
LSL-tdTomato | Jackson Labs | 007914 | ai14 |
Cre-1 | n/a | GCATTACCGGTCGATGCAACGAGTGATGAG | |
Cre-2 | n/a | GAGTGAACGAACCTGGTCGAAATCAGTGCG | |
Braf-V600E-1 | n/a | TGAGTATTTTTGTGGCAACTGC | |
Braf-V600E-2 | n/a | CTCTGCTGGGAAAGCGGC | |
Kras-G12D-1 | n/a | AGCTAGCCACCATGGCTTGAGTAAGTCTGCA | |
Kras-G12D-2 | n/a | CCTTTACAAGCGCACGCAGACTGTAGA | |
Pten-1 | n/a | ACTCAAGGCAGGGATGAGC | |
Pten-2 | n/a | AATCTAGGGCCTCTTGTGCC | |
Pten-3 | n/a | GCTTGATATCGAATTCCTGCAGC | |
tdTomato-1 | n/a | AAGGGAGCTGCAGTGGAGTA | |
tdTomato-2 | n/a | CCGAAAATCTGTGGGAAGTC | |
tdTomato-3 | n/a | GGCATTAAAGCAGCGTATCC | |
tdTomato-4 | n/a | CTGTTCCTGTACGGCATGG |
Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells' activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.
Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells' activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.
Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells' activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.