Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Journal Biology

Biology

Transfection of a Molecular Clone of Naegleria gruberi rDNA into N. gruberi Trophozoites

Published: June 21, 2024 doi: 10.3791/66726
1, 2, 3, 1
1Department of Medical Microbiology and Immunology, Creighton University School of Medicine, 2Department of Pathology and Microbiology, University of Nebraska Medical Center, 3Department of Biology, Washburn University

Abstract

All ribosomal genes of Naegleria trophozoites are maintained in a closed circular extrachromosomal ribosomal DNA (rDNA) containing element (CERE). While little is known about the CERE, a complete genome sequence analysis of three Naegleria species clearly demonstrates that there are no rDNA cistrons in the nuclear genome. Furthermore, a single DNA origin of replication has been mapped in the N. gruberi CERE, supporting the hypothesis that CERE replicates independently of the nuclear genome. This CERE characteristic suggests that it may be possible to use engineered CERE to introduce foreign proteins into Naegleria trophozoites. As the first step in exploring the use of a CERE as a vector in Naegleria, we developed a protocol to transfect N. gruberi with a molecular clone of the N. gruberi CERE cloned into pGEM7zf+ (pGRUB). Following transfection, pGRUB was readily detected in N. gruberi trophozoites for at least seven passages, as well as through encystment and excystment. As a control, trophozoites were transfected with the backbone vector, pGEM7zf+, without the N. gruberi sequences (pGEM). pGEM was not detected after the first passage following transfection into N. gruberi, indicating its inability to replicate in a eukaryotic organism. These studies describe a transfection protocol for Naegleria trophozoites and demonstrate that the bacterial plasmid sequence in pGRUB does not inhibit successful transfection and replication of the transfected CERE clone. Furthermore, this transfection protocol will be critical in understanding the minimal sequence of the CERE that drives its replication in trophozoites, as well as identifying regulatory regions in the non-ribosomal sequence (NRS).

Introduction

The Naegleria genus contains over 45 species, although it is unlikely that all members of the species have been identified1. Naegleria can exist in different forms: as trophozoites (amoebae), as flagellates, or, when resources are severely limited, as cysts1,2,3,4. The Naegleria genus is recognized for its one particularly dangerous species, Naegleria fowleri, known as 'the brain-eating amoeba' (reviewed in1,2,3,4,5,6,7), which is the cause of the almost universally fatal primary amoebic meningoencephalitis.

Naegleria encode their rDNA on the CERE located in the nucleolus. Complete sequencing of three Naegleria species' genomes confirms the absence of rDNA in the nuclear genome8,9,10,11. Based on the limited full-length CERE sequences, the CERE ranges from approximately 10 kbp to 18 kbp in length. CERE of each species of Naegleria carry a single rDNA cistron (containing the 5.8, 18, and 28S ribosomal DNA) on each of approximately 4,000 CERE per cell12,13,14. Other than rDNA, each CERE has a large non-rDNA sequence (NRS). CERE sizes vary between species; the differences are mainly due to the varying length of the NRS, as the rDNA sequences are highly conserved across the genus1,15,16,17,18,19,20. The mapping of a single origin of DNA replication within the N. gruberi CERE NRS21 provides strong support for the hypothesis that Naegleria CERE replicates independently of the nuclear genome.

N. gruberi is a non-pathogenic amoeba often used to study Naegleria biology. We developed a methodology for transforming N. gruberi trophozoites with a CERE clone from the same species to test the hypothesis that Naegleria amoebae tolerate and independently replicate CERE within the trophozoites. This was accomplished by transforming N. gruberi with a full-length clone of N. gruberi CERE into trophozoites and following the fates of the donor CERE clone by polymerase chain reaction (PCR). A general overview of the protocol is outlined in Figure 1. The data presented herein demonstrate that the donor clone can be detected through at least seven passages in tissue culture, as well as be maintained through encystment and excystment. These studies form the basis for a means to dissect how CERE replicates, as well as explore its use as a vector to transfect Naegleria.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

The details of the species, reagents, and equipment used in this study are listed in the Table of Materials. The sequence of the 17,004 base pair pGRUB construct is provided in Supplementary File 1.

1. Culturing trophozoites

  1. Thaw frozen N. gruberi trophozoites at 37 °C for 3 min.
  2. Inoculate trophozoites into T25 flasks in modified peptone/yeast extract/nucleic acid/folic acid/hemin with 10% fetal calf serum (PYNFH) media plus 2% buffer (disodium phosphate, potassium dihydrogen phosphate).
  3. Culture the trophozoites at 25 °C until ~80% confluent, where they exhibit an amoeboid morphology (Figure 2A).
    NOTE: When initially reviving a culture of trophozoites from their frozen state, it can take up to 5-7 days for a T25 to become confluent. Decant media every 3-4 days and replace with fresh media.
  4. Place the confluent flasks on ice for 5-10 min to release the adhered trophozoites from the plastic. Gently swirl the flask to dislodge any remaining adherent cells. The trophozoites now have a 'rounded up' morphology (Figure 2B).
  5. Split the cultures 1:2 to 1:4 into new tissue culture flasks.
  6. Remove the PYNFH and replace it with sterile encystment media (120 mM sodium chloride, 0.03 mM magnesium chloride, 1 mM disodium phosphate, 1 mM potassium dihydrogen phosphate, 0.03 mM calcium chloride, 0.02 mM iron chloride, pH 6.8)22 to encyst the N. gruberi.
    NOTE: The majority of trophozoites become encysted by 72 h (Figure 2C). Excystment should be completed within 72 h.
  7. Remove cysts from flasks, centrifuge at 600 x g for 10 min at 20 °C, and resuspend cysts in PYNFH media with 10% fetal calf serum to excyst the cells. Incubate at 25 °C for 24 h until trophozoites begin to emerge.

2. Transfecting trophozoites

  1. Plate the trophozoites into a 6-well flat-bottomed tissue culture plate (1 mL of 1 x 106 trophozoites/mL) and culture at 25 °C.
  2. Transfect the cells when they reach 70%-80% confluent (~10.4 x 104 cells/cm2 in 6-well clusters). Warm the transfection reagent to room temperature before use.
  3. Prepare the plasmid-transfection reagent mixture as follows: 75 ng of plasmid DNA and 0.225 µL of the transfection reagent in 200 µL of PYNFH media without FBS. Prepare sufficient plasmid-transfection reagent mixture to perform transfection in duplicate.
    NOTE: A bacterial plasmid containing a full-length clone of N. gruberi CERE (pGRUB) was used in this study. Empty plasmid (pGEM) was used as a negative control (Figure 3).
  4. Incubate the plasmid-transfection reagent mixture at room temperature for 10 min.
  5. Remove ~800 µL of medium from the trophozoite monolayers just prior to transfection.
  6. Put the plasmid-transfection reagent mixture on the trophozoites.
  7. Gently swirl the plate every 15 min to prevent the media from aggregating at the edges of the plate.
  8. Wash the monolayers once with 2 mL of growth medium after 1 h incubation at 25 °C.
  9. Treat the monolayers with 10 U DNase in 1 mL of 10x DNase buffer for 15 min at 37 °C to remove residual plasmid DNA, wash once with growth medium, add 2 mL of fresh media, and place at 25°C. Incubate the plate for 24-36 h.
  10. Place the plate on ice for 10 min to release cells.
  11. Split one well (1:2) into two new wells.
  12. Collect trophozoites from the remaining wells for experimental purposes.
    NOTE: All cultures are performed in duplicate. For each condition, 1 well is used for passage, and 1 is used for CERE isolation.

3. Isolating CERE from Naegleria

  1. Calculate the number of trophozoites in each well used for CERE isolation by trypan blue exclusion staining and a hemocytometer23.
  2. Place the trophozoites in a 2.0 mL tube.
  3. Wash trophozoites once in 100 mM sodium chloride (pH 7.5) via centrifugation (600 x g, 10 min, 4 °C).
    NOTE: Sodium chloride prevents the trophozoites from adhering to the sides of the tube.
  4. Remove the supernatant and resuspend cell pellets in 100 µL of 100 mM EDTA (pH 7.5).
  5. Place the tube in a heat block for 15 min at 98 °C to lyse the cells and inactivate the enzymes in the trophozoites.
    NOTE: This step inactivates DNases, which are abundant in Naegleria trophozoites. DNases may interfere with the ability to detect native CERE and the molecular clone in step 4. DNA yield is decreased when over ~3 x 106 cells are used in step 3.4.
  6. Centrifuge the tubes at top speed (16,000 x g) at 4 °C for 10 min to pellet the debris.
  7. Transfer the supernatants to a new tube.
  8. Ethanol precipitate the supernatants with 0.5 volumes of 7.5 M ammonium acetate (pH 7.5), 3 volumes of absolute ethanol, and 1 µL of 10 mg/mL glycogen as a carrier.
  9. Invert the tube several times and place the tube at -80 °C for at least 1 h or overnight.
  10. Warm the samples to room temperature.
  11. Centrifuge the tubes at room temperature for 10 min at 16,000 x g.
  12. Remove the supernatant and wash the pellet with 70% ethanol by centrifugation for 5 min at 16,000 x g (at room temperature).
  13. Remove ethanol and air-dry the pellet for 5 min.
  14. Resuspend the dried pellet in sterile deionized (DI) water. Normalize volume to 10,000 trophozoites per µL.
  15. Store at -80 °C until use in PCR.

4. PCR detection of transformed trophozoites

  1. Use 20,000 cell equivalents of DNA, 600 nM primers (Table 1), and Taq polymerase and perform the PCR24.
    NOTE: Primers that distinguish between native CERE and the cloned CERE are listed in Table 1, as are the PCR conditions. Figure 3 shows the location of the primers on the constructs. PCR will require optimization depending on the primers used as well as the specific PCR mix utilized.
  2. Microwave 0.8% agarose in 1x Tris base, acetic acid, and EDTA (TAE) buffer until the agarose is dissolved.
  3. Cool the agarose to ~50 °C at room temperature.
  4. Pour the solution into a gel casting tray containing a comb to form wells.
  5. Let the gel sit at room temperature until solidified.
  6. Place the gel in the electrophoresis apparatus.
  7. Decant 1x TAE into the electrophoresis chamber until the gel is covered.
  8. Remove the comb.
  9. Add 6x loading dye (0.25% bromphenol blue, 0.25% xylene cyanol, 30% glycerol) to samples and load the gel. Use a DNA ladder to determine the size of the PCR product.
  10. Attach the electrode, turn on the power supply, and run the gel at 80 V for ~1.5-2 h.
  11. Turn off the power and remove the gel.
  12. Stain the gel with DNA dye (e.g., 10 µL of 10 mg/mL ethidium bromide) in 100 mL of DI water for 10 min.
  13. Destain the gel for 20 min in DI water.
  14. Visualize gel on an ultraviolet (UV) light system and document the results.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

PCR of trophozoites that have been transfected with pGRUB demonstrates that the transfected CERE is detected through at least seven passages of the trophozoites, as well as encystment and excystment (Figure 4). The primers used in the PCR anneal to both the pGEM vector and the CERE sequence, thereby ensuring that the PCR does not detect native CERE. PCR following transfection of pGEM into trophozoites indicated that pGEM was negative (Figure 4), indicating that the empty plasmid was not retained by the amoebas. Figure 4 demonstrates that pGEM was lost by the first passage - subsequent passages, encystment, and excystment were all negative.

Figure 1
Figure 1: Flow chart of the transfection procedure. Please click here to view a larger version of this figure.

Figure 2
Figure 2: N. gruberi (NEG-M strain) trophozoites in culture. (A) Under standard culture conditions at 25 °C, N. gruberi trophozoites are ameboid in morphology and adherent to the culture flasks/plates. The arrow indicates a pseudopod that is used to propel the trophozoite directionally. (B) Following incubation of the N. gruberi culture on ice, trophozoites become round in morphology and non-adherent. (C) Following incubation in encystment media for 24-48 h, N. gruberi trophozoites become encysted. Scale bars: 10 µm. Please click here to view a larger version of this figure.

Figure 3
Figure 3: pGRUB construct used to transfect N. gruberi (NEG-M). The full-length CERE of N. gruberi (EBM strain, 14,007 bp; red) was cloned into pGEM7Zf(+) (2,997 bp; green), resulting in a construct of 17,004 bp. Arrows on each plasmid indicate the location of the PCR primers. Please click here to view a larger version of this figure.

Figure 4
Figure 4: PCR results detecting transfected pGRUB and pGEM into N. gruberi trophozoites. PCR demonstrates that pGRUB is detected in transfected trophozoites through at least seven passages, encystment (En), and excystment (Ex). pGEM is lost after the first passage of the trophozoites. P1 = passage 1, P7 = passage 7. Negative controls (neg) received no DNA in the PCR, while positive controls (pos) are either pGRUB or pGEM input into the PCR. Expected product sizes are 656 bp (pGRUB) and 337 bp (pGEM). Figures on the left of panel A indicate the size of the brightest bands of the DNA ladder. Please click here to view a larger version of this figure.

Primer Name Sequence - 5'->3' Tm Product Size
pGEM-forward CTCTTCGCTATTACGCCAGC 54 337 bp
pGEM-reverse TTGTGTGGAATTGTGAGCGG 337 bp
pGRUB-forward AGCCCCCGATTTAGAGCTTG 60.5 656 bp
pGRUB-reverse TCGGCTAGAAATGAAGTGAGGAC 656 bp

Table 1: PCR primers and conditions used in these studies.

Supplementary File 1: The sequence of the 17,004 base pair pGRUB construct. Please click here to download this File.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

The protocol outlined herein is very straightforward, although every construct will likely require some degree of optimization, particularly of the DNA-transfection reagent ratio, depending on the nature of the construct and the species of Naegleria used. We have only tested one commercially available transfection reagent using this protocol, but it is likely that several others may be effective. Given that a full-length clone of the CERE is used, containing a functional origin of replication and thus replicating autonomously, the construct possesses all necessary eukaryotic replication machinery. If a partial clone were to be inserted in the pGEM vector, the transfected clone would be predicted to be lost very soon after transfection if it does not contain a functional eukaryotic origin of replication, similar to the empty pGEM vector (Figure 2B). Furthermore, these data demonstrate that the presence of prokaryotic DNA does not interfere with the ability of the molecular clone to be retained by the trophozoite.

While there has been one reported instance of transfection of N. gruberi trophozoites25, the insert used in the present study is considerably larger (~17 kbp) than what was transfected in the prior study (<1 kbp). While it is unknown what the maximum size plasmid can be tolerated by the Naegleria, unpublished data from our laboratory has determined that amebae of another genus (Willaertia) contain CERE that are approximately 24 kbp in size.

A key step in ensuring that this protocol detects DNA within the trophozoite is the DNase treatment step (step 2.9), which ensures that residual DNA (that is, DNA that has not been transfected) is eliminated from the cultures. A couple of quality control procedures were performed to ensure the integrity of the protocol. First, the constructs were sequenced. Second, the PCR products were also sequenced to confirm their identity and ensure that there was no contamination of the assay and confirmed that the PCR products were not the result of mispriming.

While successful transfection of a plasmid with a eukaryotic origin of replication was demonstrated, it is clear from Figure 4 that there is a diminution of the PCR signal following the first passage of the trophozoites. qPCR was performed on the transfected trophozoites over time, and it was determined that the level of pGRUB drops from approximately 1,600 copies in passage 1 to 35 in passage 7 (data not shown), indicating that the transfected plasmid will likely be lost within the next several passages. This is not unexpected, as the transfected plasmid is foreign to the trophozoites and would either be viewed as unnecessary or detrimental to the survival of the amoeba.

There is a fundamental lack of knowledge regarding the CERE of the Naegleria. The majority of CERE sequences in GenBank are partial sequences, with the main focus being on the rDNA and the internal transcribed spacer (ITS) regions, which are used for identifying genus (ITS1) and species (ITS2)1,26,27. While the sequence of the rDNA subunits is highly conserved between Naegleria sp., the NRS of the Naegleria sp. varies greatly, both in size and sequence, ranging from approximately 5.5 kbp to 10 kbp1,15,16,17,18,19,20. The function of the NRS in Naegleria is largely unexplored territory, but it is presumed to contain regulatory elements including, but not limited to, an origin of replication, a promoter, and a termination sequence17. Based on the complete CERE sequences in GenBank, a common feature of Naegleria CERE is the presence of repeat regions in the NRS that are A-T rich. The function of these regions is currently unknown.

The ability to transfect Naegleria trophozoites permits the study of several aspects of CERE NRS biology, particularly the dynamics and requirements of CERE replication. In Escherichia coli, G-quadruplexes have been identified in the promoter regions of some genes28. G-quadruplex structures have also been identified in the promoters of a wide variety of eukaryotes, including mice, rats, humans, and non-human primates29. In silico analysis of several different full-length CERE sequences demonstrates that multiple areas of the NRS are predicted to form G-quadruplex structures. One area of predicted G quadruplex structures in the NRS of several Naegleria sp. is upstream of the beginning of the 18S gene. The ability to transfect trophozoites would permit exploration of identifying the promoter region of the rDNA in the CERE of Naegleria by deleting/mutating sequences upstream of the rDNA. Likewise, similar studies could be performed to identify sequences that terminate rDNA transcription.

The retention of the full-length CERE in the trophozoites for a number of passages will allow for studies that focus on identifying the minimal area of the NRS needed for replication of the CERE. While a region of the CERE has been identified as the putative origin of replication20, it is unknown whether secondary structures outside of the region are required for CERE replication or whether the region could be significantly truncated and the ori remain functional. The repetitive elements in the NRS are found in all Naegleria sp. sequenced to date15,16,17,18,19,20. The purpose of these sequences is currently unknown. Whether they exist as a regulatory element, or if they are deleted, will the CERE replicate in the trophozoites is still unknown. The repetitive sequences are species-specific in Naegleria, but whether the sequences from one species can function in another is not known. In short, there are myriad questions regarding CERE biology that can now be addressed using the technique described herein.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No financial conflicts of interest were declared.

Acknowledgments

These studies were partially funded by a grant from the George F. Haddix Fund of Creighton University (KMD). Figure 1 is generated in biorender.com, and Figure 3 is generated in benchling.com.

Materials

Name Company Catalog Number Comments
Agarose Bio Rad 161-3102
Ammonium Acetate Sigma Aldrich A-7330
Calcium Chloride Sigma Aldrich C-4901
Crushed ice
Culture Flasks, T-75 Thermo Scientific 130190
Culture Plate, 6-well Corning 3506
DNAse Sigma Aldrich D-4527
EDTA, 0.5 M Affymetrix 15694
Electropheresis Gel Apparatus Amersham Biosciences 80-6052-45
Eppendorf Tubes, 1.5 mL Fisher Scientific 05-408-129
Eppendorf Tubes, 2 mL Fisher Scientific 05-408-138
Ethanol, 100% Decon Laboratories 2716
Ethidium Bromide Sigma Aldrich E-8751
Fetal Bovine Serum Gibco 26140
Folic Acid Sigma Aldrich F7876-25G
GeneRuler 1 kb Plus Ladder Thermo Scientific SM1331
Glacial Acetic Acid Fisher Scientific UN2789
GoTaq Green PCR Master Mix Promega M7122
Heating Block Thermo Scientific 88871001
Hemacytometer Hausser Scientific 1483
Hemin Sigma Aldrich 51280
Iron Chloride Sigma Aldrich 372870-256
Ligase NEB M2200S
Magneisum Chloride Fisher Scientific M33-500
Microfuge Thermo Scientific MySpin 12
Microscope Nikon TMS
N. gruberi ATCC 30224
Nucleic Acid Chem Impex Int’l #01625
Peptone Gibco 211677
pGEM Promega P2251
Potassium Phosphate Sigma Aldrich P0662-500G
PowerPac HC Electropharesis Power Supply Unit Bio Rad 1645052
Sodium Chloride MCB Reagents SX0420
Sodium Phosphate, dibasic Sigma Aldrich S2554
Tabletop Centrifuge eppendorf 5415R
Tris, base Sigma Aldrich T1503-1KG
Trypan Blue, 0.4% Gibco 15250-061
ViaFect Reagent Promega E4981
Weigh Scale Denver Instruments APX-60
Yeast Extract Gibco 212750

DOWNLOAD MATERIALS LIST

References

  1. De Jonckheere, J. F. What do we know by now about the genus Naegleria. Exp Parasitol. 145 (Suppl), S2-S9 (2014).
  2. De Jonckheere, J. F. A century of research on the Amoeboflagellate genus Naegleria. Acta Protozool. 41, 309-342 (2002).
  3. Fulton, C. Cell differentiation in Naegleria gruberi. Annu Rev Microbiol. 31, 597-629 (1977).
  4. Grace, E., Asbill, S., Virga, K. Naegleria fowleri: Pathogenesis, diagnosis, and treatment options. AAC. 59 (11), 6677-6681 (2015).
  5. Moseman, E. A. Battling brain-eating amoeba: enigmas surrounding immunity to Naegleria fowleri. PLOS Pathog. 16 (4), e1008406 (2020).
  6. Marciano-Cabral, F. Biology of Naegleria spp. Microbiol Rev. 52 (1), 114-133 (1988).
  7. Piñero, J. E., Omaña-Molina, M., Chávez-Munguía, B., Lorenzo-Morales, J. Naegleria fowleri. Trends Parasitol. 35 (10), 848-849 (2019).
  8. Zysset-Burri, D. C., et al. Genome-wide identification of pathogenicity factors of the free-living amoeba Naegleria fowleri. BMC Genomics. 15, 496-510 (2014).
  9. Liechti, N., Schürch, N., Bruggmann, R., Wittwer, M. The genome of Naegleria lovaniensis, the basis for a comparative approach to unravel pathogenicity factors of the human pathogenic amoeba N. fowleri. BMC Genom. 19, 654-665 (2018).
  10. Liechti, N., Schürch, N., Bruggmann, R., Wittwer, M. Nanopore sequencing improves the draft genome of the human pathogenic amoeba Naegleria fowleri. Sci Reports. 9, 16040-16049 (2019).
  11. Fritz-Laylin, L. K., Ginger, M. L., Walsh, C., Dawson, S. C., Fulton, C. The Naegleria genome: A free-living microbial eukaryote lends unique insights into core eukaryotic cell biology. Res Microbiol. 162, 607-618 (2011).
  12. Clark, C. G., Cross, G. A. M. rRNA genes of Naegleria gruberi are carried exclusively on a 14-kilobase-pair plasmid. Mol Cell Biol. 7 (9), 3027-3031 (1987).
  13. Clark, C. G., Cross, G. A. M. Circular ribosomal RNA genes are a general feature of schizopyrenid amoebae. J Protozool. 35 (2), 326-329 (1988).
  14. Dao, F. Y., et al. Identify origin of replication in Saccharomyces cerevisiae using two-step feature selection technique. Bioinformatics. 35 (12), 2075-2083 (2019).
  15. Mullican, J. C., Chapman, N. M., Tracy, S. Complete genome sequence of the circular extrachromosomal element of Naegleria gruberi strain EGB ribosomal DNA. Genome Announc. 6 (6), e00020-e00021 (2018).
  16. Mullican, J. C., Drescher, K. M., Chapman, N. M., Tracy, S. Complete genome sequence of the Naegleria fowleri (strain LEE) closed circular extrachromosomal ribosomal DNA element. Microbiol Resource Announce. 9 (49), e01055-e01020 (2020).
  17. Nguyen, B. T., Chapman, N. M., Tracy, S., Drescher, K. M. The extrachromosomal elements of the Naegleria amoebae: How little we know. Plasmid. 115, 102567 (2021).
  18. Nguyen, B. T., et al. Complete sequence of the closed circular extrachromosomal element (CERE) of Naegleria australiensis De Jonckheere (strain PP 397). Microbiol Resource Announce. 12, e0032123 (2023).
  19. Nguyen, B. T., Chapman, N. M., Stessman, H. A. F., Tracy, S., Drescher, K. M. Complete sequence of the closed circular extrachromosomal element of Naegleria jadini Willaert and Ray (Strain ITMAP400). Microbiol Resource Announce. 12 (4), e0006123 (2023).
  20. Nguyen, B. T., et al. Complete sequence of the closed circular extrachromosomal element (CERE) of Naegleria pringsheimi De Jonckheere (strain Singh). Microbiol Resource Announce. 13 (4), (2024).
  21. Mullican, J. C., Chapman, N. M., Tracy, S. Mapping the single origin of replication in the Naegleria gruberi extrachromosomal DNA element. Protist. 170, 141-152 (2019).
  22. Sohn, H. J., et al. Efficient liquid media for encystation of pathogenic free-living amoebae. Korean J Parasitol. 55 (3), 233-238 (2017).
  23. Strober, W. Trypan blue exclusion test of cell viability. Curr Protoc Immunol. 111, A3.B.1-A3.B.3 (2001).
  24. Lorenz, T. C. Polymerase Chain Reaction: Basic protocol plus troubleshooting and optimization strategies. J Vis Exp. 63, e3998 (2012).
  25. Jeong, S. R., et al. Expression of the nfa1 gene cloned from pathogenic Naegleria fowleri in non-pathogenic N. gruberi enhances cytotoxicity against CHO target cells in vitro. Infect Immun. 73 (7), 4098-4105 (2005).
  26. Clark, C. G., Cross, G. A. M., De Jonckheere, J. F. Evaluation of evolutionary divergence in the genus Naegleria by analysis of ribosomal DNA plasmid restriction patterns. Mol Biochem Parasitol. 34 (3), 281-296 (1989).
  27. De Jonckheere, J. F. Sequence variation in the ribosomal internal transcribed spacers, including the 5.8S rDNA, of Naegleria spp. Protist. 149 (3), 221-228 (1998).
  28. Rawal, P., et al. Genome-wide prediction of G4 DNA as regulatory motifs: Role in Escherichia coli global regulation. Genome Res. 16 (5), 644-655 (2006).
  29. Yadav, V. K., Abraham, J. K., Mani, P., Kulshrestha, R., Chowdhury, S. QuadBase: Genome-wide database of G4 DNA - occurrence and conservation in human, chimpanzee, mouse and rat promoters and 146 microbes. Nucleic Acids Res. 36, D381-D385 (2007).

Tags

Naegleria amoebas trophozoite transfection
This article has been published
Video Coming Soon
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nguyen, B. T., Chapman, N. M.,… More

Nguyen, B. T., Chapman, N. M., Mullican, J. C., Drescher, K. M. Transfection of a Molecular Clone of Naegleria gruberi rDNA into N. gruberi Trophozoites. J. Vis. Exp. (208), e66726, doi:10.3791/66726 (2024).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter