Method Article

Het in kaart brengen Bacteriële Functionele Netwerken en Wegen in Escherichia Coli Gebruik van synthetische Genetische Arrays

DOI:

10.3791/4056

November 12th, 2012

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Systematische, grootschalige synthetische genetische (gen-gen of epistase) interactie schermen kunnen worden gebruikt om genetische redundantie en route overspraak verkennen. Hier hebben we een high-throughput kwantitatieve synthetische genetische scala screening technologie te beschrijven, genoemd eSGA door ons ontwikkelde voor het ophelderen van epistatisch relaties en het verkennen van genetische interactie netwerken in Escherichia coli.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Fenotypen bepaald door een complexe reeks fysieke (bv. eiwit-eiwit) en functionele (bijv. gen-gen of genetische) interacties (GI) 1. Terwijl fysieke interacties kunnen aangeven welke bacteriële eiwitten worden geassocieerd als complexen, doen ze niet per se onthullen pad-level functionele relationships1. GI schermen, waarbij de groei van dubbele mutanten voorzien van twee genen verwijderd of geïnactiveerd wordt gemeten en vergeleken met de overeenkomstige enkelvoudige mutanten kunnen verlichten epistatisch afhankelijkheden tussen loci en dus een middel op te vragen en te ontdekken nieuwe functionele relaties 2. Grootschalige GI maps gemeld voor eukaryote organismen zoals gisten 3-7, maar GI informatie blijft dun voor prokaryoten 8, dat de functionele annotatie van bacteriële genomen belemmert. Hiertoe hebben wij en anderen ontwikkeld high-throughput kwantitatieve bacteriële GI screeningsmethoden 9, 10 Hier presenteren we de belangrijkste stappen die nodig zijn om kwantitatieve E. uit te voeren coli Genetic Synthetic Array (eSGA) screening procedure op genoom-schaal 9, met natuurlijke bacteriële conjugatie en homologe recombinatie systemisch genereren en de geschiktheid van grote aantallen dubbele mutanten in een array formaat kolonie te meten. kort wordt een robot gebruikt voor het doorschakelen , door middel van conjugatie, chlooramfenicol (Cm) - gemarkeerde mutante allelen van engineering HFR (hoge frequentie van recombinatie) "donor stammen 'in een geordende reeks van kanamycine (Kan) - gemarkeerde F-ontvanger stammen. Typische toepassingsgebieden loss-of-function enkele mutanten richting niet-essentieel gen deleties (bijvoorbeeld de 'Keio' collectie 11) en essentiële gen hypomorphic mutaties (bijvoorbeeld allelen verleent verminderde eiwitexpressie stabiliteit of activiteit 9, 12, 13) te bevragen de functionele verenigingen van niet-essentiële en essentiële genen, respectively. Na conjugatie en daaropvolgende genetische uitwisseling gemedieerd door homologe recombinatie worden de resulterende dubbele mutanten geselecteerd op vast medium dat beide antibiotica. Na uitgroei worden de platen digitaal belicht en kolonie maten kwantitatief gescoord op een eigen geautomatiseerde beeldverwerkingsysteem 14. GI's worden onthuld wanneer de groeisnelheid van een dubbele mutant is ofwel significant beter of slechter dan verwachte 9. Verzwarende (of negatieve) GA vaak resulteren tussen loss-of-function mutaties in genen paren van compenserende pathways die van invloed zijn op dezelfde essentiële proces 2. Hier wordt het verlies van een gen gebufferd, zodat zowel enkelvoudige mutant levensvatbaar is. Het verlies van beide routes schadelijk is en resulteert in synthetische letaliteit of ziekte (langzame groei). Omgekeerd kunnen verlichten (of positief) interacties optreden tussen genen in dezelfde route of eiwit complex 2 alsdeletie van beide genen alleen is vaak voldoende om de normale functie van de signalisatieweg of complex zodanig dat aanvullende verstoringen niet activiteit te verminderen, waardoor groei verder verstoren. Overall kan systematisch identificeren en analyseren GI netwerken onpartijdige, wereldkaarten van de functionele samenhang tussen grote aantallen genen, waarvan pathway belangrijke informatie gemist andere benaderingen kunnen worden afgeleid 9.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. De bouw van Hfr Cavalli Donor mutante stammen door Recombineering 15, 16

De stappen voor het construeren van de donor eSGA vlekken worden hieronder beschreven. Kortom, we gebruiken gerichte λ - Rood gemedieerde homologe recombinatie 16 van geamplificeerd selecteerbare DNA-merker cassette fragmenten gegenereerd door PCR om niet-essentiële genen deletiemutanten (punt 1.1) of essentieel gen hypomorphic mutante donor stammen (paragraaf 1.2), die vervolgens worden gebruikt als te creëren 'vragen' om GI-netwerken te definiëren.

Opmerking: Tijdens h....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We hebben geschetst een stapsgewijze protocol voor het gebruik van robotica eSGA screening voor bacteriële gen functies te onderzoeken op een pad niveau door ondervragen GI. Deze benadering kan worden gebruikt om individuele genen alsmede gehele biologische systemen te bestuderen in E. coli. Voorzichtig uitvoeren van de experimentele hierboven beschreven stappen, inclusief alle passende controles en grondig analyseren en onafhankelijk valideren van de gegevens GI belangrijke aspecten voor het succes van eSGA he.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Geen belangenconflicten verklaard.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Dit werk werd ondersteund door de middelen van Genome Canada, de Ontario Genomics Institute, en de Canadese Institutes of Health Research subsidies aan JG en AE AG is een ontvanger van Vanier Canada Graduate Scholarship.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
I. Antibiotics
ChloramphenicolBioshop#CLR201
Kanamycin#KAN201
Ampicillin# AMP201
2. Luria-Bertani medium
LB powderBioshop#LBL405
AgarBioshop#AGR003
3. Bacterial Strains and Plasmids
Hfr Cavalli strain λred system (JL238)Babu et al.14.
pKD3E. coli Genetic Stock Centre, Yale
Keio E. coli F- recipient collectionNational BioResource Project (NBRP) of Japan11
Hypomorphic E. coli F- SPA-tag strainsOpen biosystems; Babu et al.14
4. Primers
pKD3-based desalted constant primersF1: 5'-GGCTGACATGGGAATTAGC-3'
R1: 5'-AGATTGCAGCATTACACGTCTT-3'
Desalted custom primersCm-R: 5'-TTATACGCAAGGCGACAAGG-3'
Cm-F: 5'- GATCTTCCGTCACAGGTAGG-3'
Desalted custom primersF2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions
F2 constant region:
5'-CATATGAATATCCTCCTTA-3'
R2 constant region:
5'-TGTGTAGGCTGGAGCTGCTTC-3'S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions
S1 constant region:
5'AGCTGGAGGATCCATGGAAAAGAGAAG -3'
S2 constant region:
5'- GGCCCCATATGAATATCCTCCTTAGTT -3'

KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential
gene SPA-tag insertion site
5. PCR and Electrophoresis Reagents
Taq DNA polymeraseFermentas# EP0281
10X PCR bufferFermentas# EP0281
10 mM dNTPsFermentas# EP0281
25 mM MgCl2Fermentas# EP0281
AgaroseBioshop# AGA002
Loading dyeNEB#B7021S
Ethidium bromideBioshop# ETB444
10X TBE bufferBioshop# ETB444.10
Tris BaseBioshop# TRS001
Boric acidSigma# T1503-1KG
0.5 M EDTA (pH 8.0)Sigma# B6768-500G
DNA ladderNEB#N3232L
6. DNA isolation and Clean-up Kits
Genomic DNA isolation and purification kitPromega#A1120
Plasmid Midi kitQiagen# 12143
QIAquick PCR purification kitQiagen#28104
7. Equipment for PCR, Transformation and Replica-pinning
Thermal cyclerBioRad, iCycler
Agarose gel electrophoresisBioRad
ElectroporatorBio-Rad GenePulser II
0.2 cm electroporation cuvetteBio-Rad
42 °C water bath shakerInnova 3100
Beckman Coulter TJ-25 centrifugeBeckman Coulter
32 °C shakerNew Brunswick Scientific, USA
32 °C plate incubatorFisher Scientific
RoToR-HDA benchtop robotSinger Instruments
96, 384 and 1,536 pin density padsSinger Instruments
96 or 384 long pinsSinger Instruments
8. Imaging Equipments
Camera standKaiser
Digital camera, 10 megapixelAny Vendor
Light boxes, Testrite 16" x 24" unitsTestrite
9. Pads or Plates Recycling
10% bleachAny Vendor
70% ethanolAny Vendor
Sterile distilled waterAny Vendor
Flow hoodAny Vendor
Ultraviolet lampAny Vendor
10. Labware
50 ml polypropylene tubesAny Vendor
1.5 ml micro-centrifuge tubesAny Vendor
250 ml conical flaksVWR# 29140-045
15 ml sterile culture tubesThermo Scientific# 366052
Cryogenic vialsVWR# 479-3221
Rectangular PlatesSinger Instruments
96-well and 384-well microtitre platesSinger InstrumentsNunc
Plate roller for sealing multi-wellSigma#R1275
platesABgene# AB-0580
Adhesive plate sealsFisher Scientific# 13-990-14
-80 °C freezerAny Vendor

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. Functional maps of protein complexes from quantitative genetic interaction data. PLoS Comput. Biol. 4, e1000065(2008).
  2. Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. Charting the genetic interaction....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Synthetic Genetic ArrayEscherichia ColiGenetic Interaction ScreeningColony Array FormatDouble Mutant AnalysisAutomated Image ProcessingChloramphenicol SelectionKanamycin SelectionHomologous RecombinationFitness Quantification

Related Articles