Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Summary

Here, we show the process of creating a cellular electric voltage reporter zebrafish line to visualize embryonic development, movement, and fish tumor cells in vivo.

Abstract

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling processes of excitable neuronal and muscular cells and many other biological processes, such as embryonic developmental patterning. However, there is a need for in vivo electrical activity monitoring in vertebrate embryogenesis. The advances of genetically encoded fluorescent voltage indicators (GEVIs) have made it possible to provide a solution for this challenge. Here, we describe how to create a transgenic voltage indicator zebrafish using the established voltage indicator, ASAP1 (Accelerated Sensor of Action Potentials 1), as an example. The Tol2 kit and a ubiquitous zebrafish promoter, ubi, were chosen in this study. We also explain the processes of Gateway site-specific cloning, Tol2 transposon-based zebrafish transgenesis, and the imaging process for early-stage fish embryos and fish tumors using regular epifluorescent microscopes. Using this fish line, we found that there are cellular electric voltage changes during zebrafish embryogenesis, and fish larval movement. Furthermore, it was observed that in a few zebrafish malignant peripheral nerve sheath tumors, the tumor cells were generally polarized compared to the surrounding normal tissues.

Introduction

Bioelectricity refers to endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane¹. Ionic exchanges across the cellular membrane, and the coupled electrical potential and current changes, are essential for signaling processes of excitable neuronal and muscular cells. In addition, bioelectricity and ion gradients have a variety of other important biological functions including energy storage, biosynthesis, and metabolite transportation. Bioelectrical signaling was also discovered as a regulator of embryonic pattern formation, such as body axes, the cell cycle, and cell differentiation¹

Protocol

The zebrafish are housed in an AAALAC-approved animal facility, and all experiments were carried out according to the protocols approved by the Purdue Animal Care and Use Committee (PACUC).

1. Tol2 Transposon Plasmid Construct Preparation

NOTE: Tol2, a transposon that was discovered in medaka fish, has widely been used in the zebrafish research community^8,9. It has been successfully adopted to the Gateway site-specific recombination-based cloning system and known as the Tol2 kit¹⁰. The Tol2 kit allows for a more convenient way of cre....

Results

In a successful injection, more than 50% injected fish embryos will display some degree of green fluorescence in the somatic cells, and most of them will be positive by Tol2 transposon excise assay (Figure 2). After 2-4 generations of out-cross with wildtype fish (until the fluorescent fish reach 50%, the expected Mendelian ratio), the transgenic fish were used for the imaging experiment to track cell membrane potentials during embryonic development. First, m.......

Discussion

Although the cellular and tissue level electrical activities during embryonic development and human disease were discovered a long time ago, the in vivo dynamic electrical changes and their biological roles still remain largely unknown. One of the major challenges is to visualize and quantify the electrical changes. Patch clamp technology is a break-through for tracking single cells, but its application to vertebrate embryos is limited because they are composed of many cells. The current chemical voltage dyes ar.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
14mL cell culture tubes	VWR	60818-725	E.Coli culture
Agarose electrophoresis tank	Thermo Scientific	Owl B2	DNA eletrophoresis
Agarose RA	Amresco	N605-500G	For making the injection gels
Attb1-ASAP1-F primer	IDT DNA	GGGGACAAGTTTGTACAAAAAA GCAGGCTTCACCATGGAGACGA CTGTGAGGTATGAACA	ASAP1 coding region amplification for subcloning
Attb2-ASAP1-R primer	IDT DNA	GGGGACCACTTTGTACAAGAAA GCTGGGTCTTAGGTTACCACTTC AAGTTGTTTCTTCTGTGAAGCCA	ASAP1 coding region amplification for subcloning
Bright field dissection scope	Nikon	SMZ 745	Dechorionation, microinjection, mounting
Color camera	Zeiss	AxioCam MRc	Fish embryo image recording
Concave slide	VWR	48336-001	For holding fish embryos during imaging process
Disposable transfer pipette 3.4 ml	Thermo Scientific	13-711-9AM	Fish embryos and water transfer
Endonuclease enzyme, Not I	NEB	R0189L	For linearizing plasmid DNA
Epifuorescent compound scope	Zeiss	Axio Imager.A2	Fish embryo imaging
Epifuorescent stereo dissection scope	Zeiss	Stereo Discovery.V12	Fish embryo imaging
Fluorescent light source	Lumen dynamics	X-cite seris 120	Light source for fluorescence microscopes
Forceps #5	WPI	500342	Dechorionation and needle breaking
Gateway BP Clonase II Enzyme mix	Thermo Scientific	11789020	Gateway BP recombination cloning
Gateway LR Clonase II Plus enzyme	Thermo Scientific	12538120	Gateway LR recombination cloning
Gel DNA Recovery Kit	Zymo Research	D4002	DNA gel purification
Loading tip	Eppendorf	930001007	For loading injection solution into capilary needles
Methylcellulose (1600cPs)	Alfa Aesar	43146	Fish embryo mounting
Methylene blue	Sigma-Aldrich	M9140	Suppresses fungal outbreaks in Petri dishes
Microinjection mold	Adaptive Science Tools	TU-1	To prepare agaorse mold tray for holding fish embryos during injection
Microinjector	WPI	Pneumatic Picopump PV820	Microinjection injector
Micro-manipulator	WPI	Microinjector MM3301R	Microinjection operation
Micropipette puller	Sutter instrument	P-1000	For preparing capillary needle
Mineral oil	Amresco	J217-500ml	For calibrating injection volume
mMESSAGE mMACHINE SP6 Transcription Kit	Thermo Scientific	AM1340	mRNA in vitro transcription
Monocolor camera	Zeiss	AxioCam MRm	Fish embryo image recording
Plasmid Miniprep Kit	Zymo Research	D4020	Prepare small amount of plasmid DNA
Plastic Petri dishes	VWR	25384-088	For holding fish or fish embryos during imaging process
RNA Clean & Concentrator-5	Zymo Research	R1015	mRNA cleaning after in vitro transcription
Spectrophotometer	Thermo Scientific	NanoDrop 2000	For measuring DNA and RNA concentrations
Stage Micrometer	Am Scope	MR100	Microinjection volume calibration
Thermocycler	Bio-Rad	T100	DNA amplification for gene cloning
Thin wall glass capillaries	WPI	TW100F-4	Raw glass for making cappilary needle
Tol2-exL1 primer	IDT DNA	GCACAACACCAGAAATGCCCTC	Tol2 excise assay
Tol2-exR primer	IDT DNA	ACCCTCACTAAAGGGAACAAAAG	Tol2 excise assay
TOP10 Chemically Competent E. coli	Thermo Scientific	C404006	Used for transformation during gene cloning
Tricaine mesylate	Sigma-Aldrich	A5040	For anesthetizing fish or fish embryos
UV trans-illuminator 302nm	UVP	M-20V	DNA visualization
Water bath	Thermo Scientific	2853	For transformation process of gene cloning