Die Induktion der mütterliche Immunaktivierung bei Mäusen in der Mitte der Schwangerschaft Bühne mit Viral Mimic Poly (I: C)
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
Das Konzept der mütterlichen Immunaktivierung (MIA) stammt aus den epidemiologischen Studien über die Assoziation der Infektion der Mutter mit Autismus und Schizophrenie 1. Aufgrund des Fehlens von nachweisbarem replizierenden viralen Pathogenen in der Plazenta oder fetalen Gehirn nach mütterlichen Virusinfektion 2,3, wird die Wirkung der Infektion auf die Nachkommen Hypothese eher durch die Aktivierung des mütterlichen Immunsystem verursacht werden , als die Pathogene selbst .
Polycytidylsäure: Um die Ursache-Wirkungs-Beziehung zwischen MIA und psychiatrischen Störungen, die Injektion von chemisch synthetisierten, viral mimic doppelsträngige RNA polyinosinic aufzuklären (poly (I: C)) in schwangeren Nagetieren wurde als Tiermodell für MIA weit verbreitet 4,5. Poly (I: C) von Toll-like-Rezeptor erkannt wird 3 (TLR3) und die systemische Verabreichung von Poly (I: C) induziert viral wie akute Entzündungsreaktion. Einer der Mechanismen, durch die poly (I: C) produces Verhaltensstörungen und Neuropathologien bei den Nachkommen wird durch ein Ungleichgewicht von pro- und anti – inflammatorischen Zytokinen in der mütterlichen Plazenta-fetalen Achse 6 verursacht. Mehrere Gruppen haben die MIA – Modell angenommen , die Ätiologie von psychiatrischen Störungen 7 und aufgrund der unterschiedlichen Interessen zwischen Forschungsgruppen, verschiedenen Zeitpunkten der Immunaktivierung verwendet worden , um zu verstehen , 7 verschiedene Störungen auf die Entwicklung des Gehirns und das Verhalten zu erreichen.
Das Paul H. Patterson Labor am California Institute of Technology nimmt die Strategie der Injektion von Poly (I: C) in trächtigen Mäusen an embryonalen 12,5 Tage (E12,5), die erfolgreich unter Beweis gestellt hat, dass MIA induzieren Verhaltens-, neurologische fähig ist, und immunologische Veränderungen bei den Nachkommen , die mit Autismus und Schizophrenie 8-11 verbunden sind. Unser Stand der Arbeiten zeigen , dass MIA Nachwuchs Verhaltensauffälligkeiten zeigen (zB soziale impairment, Kommunikationsdefizit, repetitive Verhalten, Angst-ähnliches Verhalten und latente Hemmung Defizit 8,10,12), Immundysregulation und Zytokine Ungleichgewicht 8,13,14, Veränderung des fötalen Gehirns Genexpression 15, Verlust der Purkinje – Zellen in Läppchen VII von Cerebellum 11, Veränderung der synaptischen Eigenschaften in Hippocampus 9, Gen – Umwelt – Interaktion x 13, Veränderung der Darmdurchlässigkeit und Darmmikrobiota Zusammensetzung 16. Darüber hinaus werden therapeutische und prophylaktische Strategien auch von diesem Modellsystem 13,16,17 entwickelt. Durch die Induktion MIA bei E12,5, andere haben gezeigt , dass MIA fötalen Mikrogliaaktivierung und cholinergen Entwicklungs Veränderung in basalen Vorderhirns 18, Stamm spezifische Wechselwirkung 19, Gehirn zerebralen synaptosomaler ultra Anomalien, zerebrale mitochondrialen Atmungskette Überfunktion abnormalties, Herabregulation der zerebralen synaptischen Moleküle 17 erzeugt .depressiv-ähnliche Verhaltensweisen, Beeinträchtigung der Kognition und des Hippocampus Langzeit – Potenzierung (LTP), und das Defizit von Erwachsenen Neurogenese im Hippocampus 20.
Hier bieten wir eine detaillierte Methode, wie MIA zu induzieren bei E12,5 von Poly (I: C), sowie Paradigmen, wie dieses Modell anzuwenden, um die Entstehung von Autismus und Schizophrenie zu studieren. Es ist wichtig zu beachten , dass MIA ein Risikofaktor für eine Vielzahl von Erkrankungen ist 4, und dessen Ergebnisse sind extrem empfindlich gegenüber der Zeit und Methode der Induktion sowie die Haltung der trächtigen Muttertieren. Als solche auch kleinere Unstimmigkeiten zwischen den Laboratorien führen oft zu geringe Reproduzierbarkeit und / oder unterschiedlichen Phänotypen bei den Nachkommen. Unsere Methode ist für die Interessenten an einem Studium MIA als Umweltrisikofaktor für Autismus und Schizophrenie speziell entwickelt, und die detaillierte Beschreibung wird es den Forschern zur Verfügung gestellt helfen, die Reproduzierbarkeit ihrer Daten zu verbessern.
Protocol
Representative Results
Discussion
MIA Induktion zu unterschiedlichen Zeitfenstern stört unterschiedliche Entwicklung des Gehirns Ereignisse bei Nagern und folglich führt zu unterschiedlichen Verhaltensstörungen und Neuropathologien bei den Nachkommen. Hier beschrieben wir ein Protokoll zu induzieren MIA in Mäusen, die mit Poly (I: C) Injektion an E12.5. Diese Methode der MIA Induktion führt zu Verhaltens, neurologische, immunologische und Magen – Darm – Anomalien im Zusammenhang mit Autismus und Schizophrenie bei den Nachkommen 8,10,11,16.</su…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Wir möchten, dass der verstorbene Dr. Paul H. Patterson für seine Beiträge zum Fortschritt der MIA-Modell zu ehren, Autismus und Schizophrenie-Forschung. Wir erkennen an Sarkis K. Mazmanian für seine große Unterstützung auf diesem Protokoll; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni und Leslie A. Neumann für administrative Unterstützung; Ali Khoshnan und Jan C. Ko für die Unterstützung bei der Verfilmung; Elaine Y. Hsiao und Natalia Malkova für ihre Beratung auf MIA Induktion; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandovals und Natalie A. Verduzco für ihre Fachtierhaltung. Diese Arbeit wurde durch das NIH Conte-Center-Preis (NIH 5P50MH086383-04, Paul H. Patterson) unterstützt; Autismus spricht (# 7670, Paul H. Patterson); Simons Foundation (# 322839, zu Sarkis K. Mazmanian); NIH Ausbildung Grant (NIH / NRSA T32GM07616 K.-HC); Caltech Sommer Wissenschaftliche Fellowship (SURF) (bis ZY); Amgen Scholars Program am California Institute of Technology (zu ZY); und Postdoctoral Fellowship from National Science Council, Taiwan (NSC 101-2917-I-564-039, W.-LW).
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
References
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H., et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I., et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L., et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L., et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. , (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31, 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2, e98 (2012).
- Hsiao, E. Y., et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K., et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J., et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3, e240 (2013).
- Khan, D., et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4, e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B., et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U., et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S., et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
