JoVE Journal > Medicine
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
自动翻译
Please note that all translations are automatically generated. Click here for the English version.
医学

voorbereiding en<em> In Vitro</em> Karakterisering van Magnetische miR-gemodificeerde endotheelcellen

Published: May 02, 2017
doi:
10.3791/55567
, , , , , ,
1Reference and Translation Center for Cardiac Stem Cell Therapy (RTC), Department of Cardiac Surgery,University of Rostock, 2Physikalisch-Technische Bundesanstalt, 3Department of Radiology and Neuroradiology,Ernst-Moritz-Arndt-University Greifswald, 4Electron Microscopy Center,University of Rostock

Summary

Dit manuscript beschrijft de efficiënte, niet-virale aflevering van miR aan endotheelcellen door een PEI / MNP vector en de magnetisatie. Dus behalve genetische modificatie, deze benadering voor magnetische cellen leiding en MRI detecteerbaarheid. De techniek kan worden gebruikt om de kenmerken van de therapeutische cel producten te verbeteren.

Abstract

Tot op heden, de beschikbare chirurgische en farmacologische behandelingen voor hart- en vaatziekten (HVZ) zijn beperkt en vaak palliatieve. Tegelijkertijd, gentherapie, celtherapie zijn veelbelovende alternatieve benaderingen voor CVD behandeling. Echter, de brede klinische toepassing van gentherapie sterk beperkt door het gebrek aan geschikte gen-afgiftesystemen. De ontwikkeling van geschikte genafleveringsvectoren kan een oplossing voor de huidige problemen in cel therapie. Met name bestaande nadelen, zoals beperkte efficiëntie en lage retentietijd van cellen in het beschadigde orgaan, kunnen worden overwonnen door geschikte cel techniek (dwz genetische) vóór transplantatie. De gepresenteerde protocol beschrijft een efficiënte en veilige tijdelijke modificatie van endotheelcellen behulp polyethyleenimine superparamagnetische magnetische nanodeeltjes (PEI / MNP) gebaseerde afleverende vector. Ook het algoritme en werkwijzen voor cellulaire karakterisatie gedefinieerd. De succesvolle intracellular levering van microRNA (miR) in humane navelstreng endotheelcellen (HUVEC) is verwezenlijkt zonder dat cellevensvatbaarheid, functionaliteit of intercellulaire communicatie. Bovendien werd deze aanpak blijkt een sterke functionele effect geïntroduceerde exogene miR veroorzaken. Belangrijk is dat de toepassing van deze MNP-gebaseerde vector verzekert cel magnetisatie, met bijbehorende mogelijkheden magnetische targeting en niet-invasieve MRI tracing. Dit kan als basis voor het magnetisch geleid genetisch gemanipuleerde cellen therapeutica die niet-invasief kan worden gevolgd met MRI te verschaffen.

Introduction

Gene en celtherapie zijn krachtige instrumenten die de potentie heeft om de huidige uitdagingen in de CVD behandeling op te lossen hebben. Ondanks het feit dat beide benaderingen worden momenteel getest in klinische studies, zijn ze nog niet klaar voor brede klinische toepassing 1. Met name een gemeenschappelijke benadering van de uitdagingen van gen- en celtherapie te pakken is om multifunctionele genafgifte vectoren die geschikt zijn voor klinische toepassing te ontwikkelen. Het gebrek aan veilige en efficiënte genafgifte systemen is de belangrijkste zorg van gentherapie. Tegelijkertijd, de genetische manipulatie van cellulaire producten voorafgaand aan transplantatie de grote uitdagingen van celtherapie, zoals lage efficiëntie (bijvoorbeeld in het cardiale gebied slechts ~ 5% functionele verbetering wordt bereikt na stamceltransplantatie 1 kon overwinnen ) en slechte retentie / implantatie op de plaats van letsel (dat wil zeggen, daalt celretentie dan 5-10% binnen minuten tot uren post-toepassing, ongeacht de toedieningsweg 2, 3, 4).

Tot op heden virale vectoren aanzienlijk overschrijdt niet-virale systemen qua efficiëntie, wat heeft geleid tot bredere toepassing in klinische trials (~ 67%) 5. Echter, virale vehikels dragen ernstige risico's, zoals immunogeniteit (en de daaropvolgende ontstekingsreactie met ernstige complicaties), oncogeniciteit, en beperkingen van de omvang van de uitgevoerde genetisch materiaal 6. Vanwege deze veiligheidsproblemen en de hoge kosten van virale vectorproductie, het gebruik van niet-virale systemen de voorkeur in bepaalde gevallen 7, 8. Het is bijzonder geschikt voor kwalen die transiënte genetische correctie vereisen, zoals de expressie van groeifactoren regelen van angiogenese (bijvoorbeeld voor CVD behandeling) of delivery van vaccins.

In onze groep werd een afgiftesysteem gemaakt door combineren van 25-kDa vertakte polyethyleenimine (PEI) en superparamagnetische ijzeroxide nanopartikels (MNP) gebonden door biotine-streptavidine interactie 9. Deze vector is een potentieel middel voor de genetische manipulatie van cellen, waardoor het gelijktijdig magnetisatie voorafgaand aan transplantatie. Laatstgenoemde vormt een basis voor magnetische geleiding / retentie, die bijzonder veelbelovend tegenwoordig geavanceerde magnetische targeting technieken met succes ontwikkeld 10. Bovendien is de resulterende magnetisch responsieve cellen hebben het potentieel om niet-invasief bewaakt door magnetische resonantie beeldvorming (MRI) of magnetische deeltjes imaging 11, 12.

Bij de PEI / MNP vector, polyamine zorgt nucleïnezuur condensatie en dus bescherming tegen verval factor s, vector internalisatie in cellen en endosomale ontsnappen 5. De MNP aanvulling op de eigenschappen van PEI, niet alleen qua magnetische geleiding, maar ook door het verminderen van de toxiciteit bekende PEI 7, 13, 14. Voorheen werden PEI / MNP vector eigenschappen qua afgifterendement (dwz pDNA en miRNA) en veiligheid bepalen door fibroblasten en menselijke mesenchymale stamcellen 15, 16.

In dit manuscript wordt een gedetailleerd protocol over de toepassing van PEI / MNP's voor het genereren van miRNA-gemodificeerde cellen 17 beschreven. Hiertoe worden gebruikt HUVECs en een gevestigd model voor in vitro angiogenese vertegenwoordigen. Ze zijn moeilijk te transfecteren en zijn gevoelig voor toxische invloed 18, 19,ass = "xref"> 20. Bovendien geven we een algoritme voor dergelijke cellen in vitro, waaronder het richten, intercellulaire communicatie en MRI detectie evalueren.

Protocol

Human navelstrengen voor mobiele isolatie werden postpartum verkregen van op de hoogte, gezonde vrouwen die hun schriftelijke toestemming voor het gebruik van dit materiaal voor onderzoek gaf in overeenstemming met de Verklaring van Helsinki. De ethische commissie van de Universiteit van Rostock heeft de gepresenteerde studie (reg. Nr A 2011 06, verlengde 23 september 2013) goedgekeurd. 1. Bereiding van transfectiecomplexen Biotinylering van polyethyleenimine (PEI). <…

Representative Results

Hoofddoel van de voorgestelde protocol magnetisch responsieve miR-gemodificeerde cellen en hun nauwkeurige karakterisering (figuur 1) te voeren. Hierdoor efficiënt getransfecteerde cellen, reagerend op magnetische selectie en begeleiding en detecteerbaar met MRI, worden verkregen. Ten eerste, de identiteit van geïsoleerde HUVEC's werden bevestigd door typische kleuring met endotheliale merker CD31 (PECAM…

Discussion

De productie van genetisch gemanipuleerde cellen geladen met superparamagnetische nanopartikels voor de verdere magnetisch gestuurde geleiding heeft in het huidige protocol. De succesvolle toepassing van deze strategie maakt het mogelijk voor de oplossing van een aantal problemen van celtherapie, zoals lage retentie en slechte innesteling in de gewonde gebied 2, 3, 4, door middel van een richtbare cel product voor transplantati…

Disclosures

The authors have nothing to disclose.

Acknowledgements

We willen graag G. Fulda (Electron Microscopy Center, Rostock University, Duitsland) bedanken voor de technische ondersteuning bij het verwerven van TEM beelden van gefilterde superparamagnetische nanodeeltjes en in het uitvoeren van hun X-stralen analyse. De werkzaamheden op de RTC Rostock gedragen werd ondersteund door het ministerie van Onderwijs en Onderzoek Duitsland (FKZ 0312138A, FKZ 316159 en VIP + 03VP00241) en de Staat Mecklenburg-Voor-Pommeren met de EU-structuurfondsen (ESF / IV-WM-B34- 0030/10 en ESF / IV-BM-B35-0010 / 12) en de DFG (DA 1296-1), de Damp-Foundation en de Duitse Hartstichting (F / 01/12). Frank Wiekhorst werd gesteund door de EU FP7 onderzoeksprogramma "NanoMag" FP7-NMP-2013-GROOT-7.

Materials

PEI 25 kDa Sigma Aldrich 408727
EZ-Link Sulfo-NHS-LC-Biotin Thermo Scientific 21335
PD-10 Desalting Columns GE Healthcare 17085101 Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2% Sigma Aldrich 7285
Glycine Sigma Aldrich 410225
Pierce Biotin Quantitation Kit Thermo Scientific 28005
 Microplate reader Model 680 Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles Promega Z5481
Millex-HV PVDF Filter Merck SLHV013SL 0.45µm
Libra 120 transmission electron microscope  Zeiss Acceleration Voltage 120KV
Sapphire X-ray detector EDAX-Amatek
Cell culture plastic TPP
NHS-Esther Atto 565 ATTO-TEC GmbH AD 565-31
NHS-Esther Atto 488  ATTO-TEC GmbH AD 488-31
Cy5 miRNA Label IT kit Mirus Bio MIR 9650
Biotin Atto 565 ATTO-TEC GmbH AD 565-71
Collagense Type IV Gibco Thermo Scientific 17104019
Endothelial growth medium, EGM-2 Lonza CC-3156 & CC-4176
Penicillin/Streptomycin Thermo Scientific 15140122 100 U/ml, 100µg/ml
Matrigel BD Biosciences 356234
anti-PECAM-1 antibody Santa Cruz sc-1506
MS MACS columns Miltenyi Biotec  130-042-201
Near-IR Live/Dead Cell Stain Kit Thermo Scientific L10119
Cy3 Dye-Labeled Pre-miR Negative Control Thermo Scientific AM17120 "Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules – Negative Control  Thermo Scientific AM17110 "scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor  Thermo Scientific AM10916
LSM 780 ELYRA PS.1 system Zeiss
Paraformaldehyde Sigma Aldrich 158127 4% solution in PBS
DAPI nuclear stain Thermo Scientific D1306
NucleoSpin RNA isolation Kit Machery-Nagel 740955
mirVana miRNA Isolation Kit Thermo Scientific AM1560
TaqMan MicroRNA Reverse Transcription Kit Thermo Scientific 4366596
StepOnePlus Real-Time PCR System Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814
hsa-miR-92a TaqMan assay Thermo Scientific 000431 Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix Nippon Genetics LS27
ITGA5 TaqMan assay Thermo Scientific Hs01547673_m1
RNU6B TaqMan assay Thermo Scientific 001093
18S rRNA Endogenous Control Thermo Scientific 4333760F
Gelatin Sigma Aldrich G7041
CellTrace Calcein Red-Orange Thermo Scientific C34851
PBS Pan Biotech P04-53500
BSA Sigma Aldrich
MACS buffer Miltenyi Biotec  130-091-221
Agarose Sigma Aldrich A9539
7.1 Tesla animal MRI system Bruker Corporation A7906
ImageJ software National Institutes of Health upgraded with an AngiogenesisAnalyzer (NIH)
MPS device Bruker Biospin
Matlab software Mathworks
Ring Neodym Magnet  magnets4you GmbH RM-10x04x05-G ø 10 mm; remanescence is ~1.3T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit Thermo Scientific C10340
FluorSave Reagent Merck 345789
Ultrasonic bath Bandelin electronic Type: RK 100 SH
DOWNLOAD MATERIALS LIST

References

  1. Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11 (4), 232-246 (2014).
  2. Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115 (14), 1866-1875 (2007).
  3. Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4 (2), 177-181 (2011).
  4. Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54 (17), 1619-1626 (2009).
  5. Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy – Principles and Challenges. , (2015).
  6. Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
  7. Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15 (8), 541-555 (2014).
  8. Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6 (31), 30675-30703 (2015).
  9. Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10 (8), 897-909 (2008).
  10. Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
  11. Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6 (3), 291-301 (2016).
  12. Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5 (7), 667-685 (2015).
  13. Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. , (2016).
  14. Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
  15. Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14 (6), 10710-10726 (2013).
  16. Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9 (7), 999-1017 (2014).
  17. Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12 (8), 2353-2364 (2016).
  18. Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21 (2), 66-72 (2010).
  19. Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35 (27), 7909-7918 (2014).
  20. Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91 (2), 223-227 (2012).
  21. Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211 (2), 907-913 (1954).
  22. Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34 (12), 1893-1902 (2002).
  23. Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8 (1), 28-40 (2001).
  24. Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
  25. Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
  26. Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89 (1), 41-48 (2012).
  27. Andrade, &. #. 1. 9. 4. ;. L., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324 (10), 1753-1757 (2012).
  28. Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10 (4), e0123159 (2015).
  29. Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32 (35), 9218-9230 (2011).
  30. Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
  31. Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324 (5935), 1710-1713 (2009).
  32. Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15 (9), 1989-1998 (2011).
  33. Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
  34. Cheng, K., Li, T. -. S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106 (10), 1570-1581 (2010).
  35. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. , A.3B.1-A.3B.2 (2001).
  36. Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29 (5), 1232-1241 (2012).
  37. Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12 (2), 337-346 (2016).
  38. Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8 (5), 1-10 (2013).
  39. Hernando, D., Kühn, J. -. P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37 (3), 717-726 (2013).
  40. Soenen, S. J., Rivera-Gil, P., Montenegro, J. -. M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6 (5), 446-465 (2011).
  41. Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27 (3), 85 (2008).
  42. Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
  43. Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
  44. Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
  45. Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
  46. Chen, C. -. H., Sereti, K. -. I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19 (8), 1757-1772 (2015).
  47. Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16 (10), 2413-2421 (2012).
  48. Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9 (23), 4017-4026 (2013).
  49. Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10 (1), 225-234 (2014).
  50. Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2 (8), 794-802 (2009).
  51. Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4 (6), 149 (2013).
  52. Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
  53. Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6 (7), 832-842 (2010).
  54. Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21 (6), 1121-1135 (2012).
  55. Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35 (30), 8528-8539 (2014).

Tags

Keywords: Magnetized CellsMiR-modified CellsEndothelial CellsCell MagnetizationMicroRNA TransfectionPolyethyleneimeneSuper Paramagnetic Iron Oxide NanoparticlesCell TherapyRegenerative MedicineCell RetentionCell SurvivalConfocal MicroscopyStructured Illumination Microscopy
check_url/cn/55567?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Voronina, N., Lemcke, H., Wiekhorst, F., Kühn, J., Frank, M., Steinhoff, G., David, R. Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells. J. Vis. Exp. (123), e55567, doi:10.3791/55567 (2017).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image